I use count_spacers.py to analyze the NGS results (paired-end). my code is as below:
python countspacers.py -no-g -i sgrnainput.csv -f c_1.clean.fq
my percentage of guides that matched perfectly is just 43%, and percentage of undetected guides is more than 96%:
Number of perfect guide matches: 1223
Number of nonperfect...
I am new to the use of CRISPR libraries and I would like some input regarding a problem we are having. I am. using the GeCKO v2 library according to the Joung et al. Nature protocols paper.
After library amplification we amplified the sgRNA targets by PCR using an equimolar mix of the primers foward of the paper and one of ...
Hello all
I recently amplified the human GeCKO v2 and SAM libraries following the Joung et.al. 2017 protocol. I used the count_spacers.py script with a few modifications to run with phyton 3 and obtain the following statistics.
GECKO-A ...
Purple Satyr
about 1 year ago
oligo annealing
Would you share some experience about oligo annealing?
I incubated the F- and R- oligoes in annealing buffer for 5mins at 95C, following by "let the oligo gradually anneal to RT". I am wondering how I should control this gradually temp drop?
I have 10K F- and 10K R- oligoes, and wondering whether there is any specific ste...
Purple Ghost
about 1 year ago
FACS-based CRISPR screen
I have some rather general questions.
1\. In the case of a FACS screen of differentiated cells, except from the top 10% fluorescent cells and the bottom 10% fluorescent cells (sorted control), what other samples should be included for NGS analysis?
What about the plasmid DNA library and the differentiated but not sorted c...
I am a newfie in this field. To practice before real experiment, I read the nature protocol (DOI: 10.1038/nprot.2017.016) and downloaded python code. To get the test data, I downloaded the fastq file () from the published paper (DOI: 10.1016/j.stem.2018.09.003).
Here, I performed the following code: “ python ./countspacers...
Wine Zombie
over 1 year ago
primers in Table 3 and Table 4
I am following your Nature protocol and have a few questions regarding the logic of the primers in Table 3 and Table 4.
In Table 3, there are 10 NGS-Lib-Fwd primers, and their structure is of this: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC GACGCTCTTCCGATC TatCATGCTTAgctttatatatcttgtggaaaggacgaaacacc (NGS-Lib-Fwd-2). I le...
Purple Ghost
over 1 year ago
CRISPR activation_SAM library
I'm interested in a custom CRISPR activation library using the SAM system and I have some questions:
Which are the flanking sequences for the human SAM library?
Are you aware of a dCas9 activity assay, as the one utilizing a GFP reporter assay for Cas9?,
Which format is better to use? The 2-vector or the 3-vector sys...
Green Mummy
almost 2 years ago
Basic question about preparation of the gDNA for NGS analysis
Since I am not very familiar with next-generation sequence, I have a very basic question about preparation of the gDNA for NGS analysis.
I was realized that "library preparation is the first step of next-generation sequencing. Once your libraries are prepared, you will be ready for the next step in your next generation seq...
Green Mummy
almost 2 years ago
Some puzzles about PCR purification and gel extraction
according to the protocol, when do next-generation sequencing of the amplified sgRNA library to determine sgRNA distribution. There are both PCR purification and gel extraction after PCR.
However, There is only PCR purification when doing preparation of the gDNA for NGS analysis.
**
**
I think gDNA is not as pure as t...
Find your community. Ask questions. Science is better when we troubleshoot together.
Community Guidelines
Sci Find is a place for experimentation beyond the publication. We are a growing collaborative community of scientists and experimentalists from around the world who believe science is better when we work together.
- Help us keep Sci Find a safe space for productive and collaborative conversations. Please be kind and respect your fellow community members. If you see abusive or alarming content, please report it to admin@scifind.net, and our team will take appropriate actions.
- All information posted to this page is public and Open Access. Learn more about our commitment to Open Access by visiting our Docs.
- We encourage our community to have collaborative troubleshooting discussions, and to share tips and tricks, experimental methods, resources, and opportunities.
- You must be a member to create or engage with content. Sign Up to create your profile and join the community for free.
- Follow a guild and create a post. Learn more about guilds here.
- Post titles should be descriptive and include descriptive tags. Check out our tagging guidelines here.