Mucins play an essential role in protecting the respiratory tract against microbial infections. The heavily O-glycosylated gel-forming mucins MUC5AC and MUC5B eliminate pathogens by mucociliary clearance while transmembrane mucins MUC1, MUC4, and MUC16 restrict microbial invasion at the apical surface of the epithelium. In this study, we determined the impact of host mucins and mucin glycans on SARS-CoV-2 spike-mediated epithelial entry. Human lung epithelial Calu-3 cells have endogenous expression of the SARS-CoV-2 entry receptor ACE2 and express high levels of glycosylated MUC1 on the surface but not MUC4 and MUC16. Removal of the MUC1 extracellular domain (ED) using the O-glycan-specific mucinase StcE greatly enhanced spike binding and viral infection. By contrast, removal of mucin glycans sialic acid and fucose did not impact viral invasion. This study implicates the glycosylated ED of MUC1 as an important component of the host defense that restricts the severity of SARS-CoV-2 infection.

The glycosylated extracellular domain of MUC1 protects against SARS-CoV-2 infection at the respiratory surface

For infection experiments, Calu-3 cells were grown in 96-well plates and allowed to reach around 90% confluency. Then, cells were treated with enzymes for 3 h at 37°C and 5% CO2, before they were inoculated with SARS2-S pseudotyped VSV-Luc or SARS2-S pseudotyped VSV-GFP. At 20 h postinfection, culture supernatants were aspirated, washed with DPBS, and cells were lysed by overnight incubation with Renilla luciferase assay lysis buffer (Promega) at -80°C. The next day, cell lysates were thawed, thoroughly resuspended, and transferred to white, opaque-walled 96-well plates and relative luminescence unit (RLU) was measured. Renilla luciferase activity was determined using the Luciferase Assay Systems (Promega) according to the manufacturer’s instructions. Raw luminescence values were recorded as counts per 5 seconds by Berthold Centro LB 942 plate luminometer. For SARS2-S pseudotyped VSV-GFP mediated infection, GFP positive signal captured using an EVOS microscope (Thermo Scientific) at 4X magnification and quantified using EVOS software. For infection experiments with the authentic SARS-CoV-2 virus, Calu-3 cells were prepared as described above and inoculated with approximately 200 pfu of SARS-CoV-2. At 8 h post-infection, cells were washed in PBS, fixed in formalin, permeabilized in 70% ethanol and washed in PBS again. Immunofluorescent stainings were performed as described for SARS-CoV-2 stock production and scanned plates were analyzed using ImageQuant TL software. All work with infectious SARS-CoV-2 was performed in a Class II Biosafety Cabinet under BSL-3 conditions at Erasmus Medical Center.

SARS-CoV-2 infection assays

Natural products provide a rich source of potential antimicrobials for use in treating infectious diseases for which drug resistance has emerged. Foremost among these is tuberculosis. Assessment of the antimycobacterial activity of nargenicin, a natural product that targets the replicative DNA polymerase of Staphylococcus aureus, revealed that it is a bactericidal genotoxin that induces a DNA damage response in Mycobacterium tuberculosis (Mtb) and inhibits growth by blocking the replicative DNA polymerase, DnaE1. Cryo-electron microscopy revealed that binding of nargenicin to Mtb DnaE1 requires the DNA substrate such that nargenicin is wedged between the terminal base pair and the polymerase and occupies the position of both the incoming nucleotide and templating base. Comparative analysis across three bacterial species suggests that the activity of nargenicin is partly attributable to the DNA binding affinity of the replicative polymerase. This work has laid the foundation for target-led drug discovery efforts focused on Mtb DnaE1.

DNA-dependent binding of nargenicin to DnaE1 inhibits replication in Mycobacterium tuberculosis

Purified Mtb DnaE1 was diluted to 4 μM in 20 mM PIPES pH 7.0, 50 mM potassium glutamate, 5 mM MgCl2, 2 mM DTT, and 0.01% Tween-20. The diluted protein was incubated for 5 min with 20 μM DNA substrate (Template: 5’- GATAGAGCAGAAGGACGAAGGACTCCCAACTTTAGGTG, Primer: 5’- GCACCTAAAGTTGGGAGTCCTTCGTCCT*T, where the asterisk marks the position of a phosphorothioate bond). Three μl of sample were adsorbed onto glow-discharged copper R2/1 holey carbon grids (Quantifoil). Grids were glow discharged 45 seconds at 25 mA using an EMITECH K950 apparatus. Grids were blotted for one second at ~80% humidity at 4°C and flash frozen in liquid ethane using a Leica EM GP plunge freezer. The grids were loaded into a Titan Krios (FEI) electron microscope operating at 300 kV with a Gatan K3 detector. The slit width of the energy filter was set to 20 eV. Images were recorded with EPU software (Thermo Fisher Scientific) in counting mode.

Microscopy

Skills & Expertise

Have a question?