I have experiences in RNAi and Cas9 knockout experiments in mammalian cells, but am now facing a little challenge.
I have primary chicken and duck endothelial cells that require knockdowns of genes - knockouts of these genes are impossible due to their importance for these cells.
I have seen 1-2 papers looking at CMV/Ef1a...
We recently prepared to use SAM for screening experiments, but we found that the lentivirus titer of the package was always very low, and the cells were almost dead after adding puromycin. In addition, another CRISPRa library we used (Calabrese, from john doench lab) also had such a problem. Other lentiviruses we packaged h...
Apologies for what is probably a simple question. I'm essentially hoping to mentally generate a user guide for dCas9 () akin to the PDF for the LentiCRISPR protocol, but for the dCas9 system.
Am I right that to target a gene for gain of function I should generate Lentivirus with the:
lenti dCAS-VP64_Blast, Retro, Gag/Pol ...
We try to insert sgRNAs into a Cas9 (pSpCas9(BB)-2A-Puro (PX459) V2.0) and lenticrispr-v2 vectors. Although we got a few colonies for the Cas9 vector, we cannot get for the lentivector. Any idea why?
Also, I am trying to understand how the digestion of the BbsI and the sequences of the plasmid after BbsI digestion do not c...
I am trying to clone the gRNA into the LenticrisprV2 vector from addgene ( #52961). It's my fourth try and it's still a failure. No bacteria growing in my petri dishes. I am desperate because I have tried several protocols but none have worked.
If someone has already managed to clone in this vector I would be indebted to h...
It seems like the sequencing primers from Joung et al., 2017 will bind Lentiguide Puro, LentiCRISPR v2, pXPR_050 and pXPR 502.
NGS-Fwd-1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTAAGTAGAG GCTTTATATATCTTGTGGAAAGGACGAAACACC
NGS-KO-Rev-1 CAAGCAGAAGACGGCATACGAGATTCGCCTTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CC...
I trying to generate a KO model in ha hTERT line of fibroblast using lentiCRISPR V2 with 3 gRNA. The gRNAs are desining to generate a delection between exons 1 and 3 of my gene. I already performance puromicine selection and try to validate expresion levels of mRNA for me gene in policlonal cell line but I don't get any cha...
I am using LentiCRISPR v2 to make a point mutation in HEK293T cells. I have a few general questions:
1\. Is there a defined protocol to do HDR with LentiCRISPR v2?
2\. I transduced my HEK293T cells with the LentiCRISPR v2 cassette that had my gRNA integrated into it. I saw a specific cut on the site S421 (on the huntingti...
I am planning to do the screen using lentiCRISPR v2 library and I am designing the primers for the illumina seq.
In a recent experiment I used lentiviral transduction of CRISPR to knock-out/down a gene of interest in a cell line. As a negative control I used the native lentiCRISPRv2 plasmid (with the 2kb filler) instead of the lentiCRISPRv2 plasmid cloned with a sgRNA against GFP for example. When I added the Puromycin to the cells, m...

Find your community. Ask questions. Science is better when we troubleshoot together.
Community Guidelines
Sci Find is a place for experimentation beyond the publication. We are a growing collaborative community of scientists and experimentalists from around the world who believe science is better when we work together.
- Help us keep Sci Find a safe space for productive and collaborative conversations. Please be kind and respect your fellow community members. If you see abusive or alarming content, please report it to admin@scifind.net, and our team will take appropriate actions.
- All information posted to this page is public and Open Access. Learn more about our commitment to Open Access by visiting our Docs.
- We encourage our community to have collaborative troubleshooting discussions, and to share tips and tricks, experimental methods, resources, and opportunities.
- You must be a member to create or engage with content. Sign Up to create your profile and join the community for free.
- Follow a guild and create a post. Learn more about guilds here.
- Post titles should be descriptive and include descriptive tags. Check out our tagging guidelines here.