Why the Guide RNA sequence suggested are not the same as the target region ?

I have a project concerning BRCA1 knockout,

by using crispr.mit.edu tool (V2), I cannot find a gRNA that matches perfectly my target sequence.

I'va selected the whole BRCA1 gene and selected the first 3 exons to do a cas9 assay.

The first 2 guides show a score of 99%, which is good but the sequence simply is not the same à the exon targeted sequence,

do you have an explanation for that ?

Despite the 99% score I'm not confortable with the fact that my guide won't be as same as the targeted genome sequence.

Here is the example :

Guide info

CRISPR tool type cas9

guide sequence TCTGGCTGCACAACCACAAT

5' pam sequence (N/A)

3' pam sequence TGG

target exon name EXON_1

target exon start BRCA1 3348

on-target strand 1

predicted off-targets

3

Hsu, 2013 score 99.85011394611143

On-target cut site

__ __ __ __ __ __ __ __ __ __ __ __ AAGATTTATAAATAACCATCCTCTCCCTTGCCCTTCAACATTATAGCTAAACAAAAATAA TTATTTTTGTTTAGCTATAATGTTGAAGGGCAAGGGAGAGGATGGTTATTTATAAATCTT __ __

On-target exon sequence

EXON_1 (hg38 BRCA1) guide TCTGGCTGCACAACCACAATTGG

GAGCGATACAAGATTTATAAATAACCATCCTCTCCCTTGCCCTTCAACATTATAGCTAAA

Off-target predictions

offtarget positionmismatches
NC_000021.9 38519815 +14:T>C,16:G>C,18:T>A
NC_000011.10 98392516 +6:A>T,7:A>G,8:A>C
NC_000016.10 87203142 +4:A>G,15:C>A,19:A>T

Login or Signup to leave a comment
Lavender Trollabout 4 years ago

That site is showing you off-target regions in the genome.
It is showing you other regions in the genome that might be targeted by your guide.
99 is a good score with few off target sequences.

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.