Targeting negative control

has anybody ever used a negative control which does not rely on scrambled, non-targeting principles? I am thinking of using guides against "safe harbour" locus ROSA26 or else against a non-coding area of the genome, so that they shouldn't exert any effect. Do you think that's feasible?

I am doing CRISPR interference with dCas-KRAB. Two different scrambled controls turned out to strongly reduce the viability and growth of my cells (one of them is the one by origene which has been suggested in this forum). I am quite at a loss why this happens, so if someone made similar experiences, you are also very welcome to comment on that.


Login or Signup to leave a comment
Fuchsia Kelpieover 4 years ago

I've used the following scrambled sgRNA target sequences for negative controls for all sorts of CRISPR experiments (KO, KD, activation) in all sorts of cell types without any issue in reduction in the viability of my cells, so they might be good for you to try:

CTGAAAAAGGAAGGAGTTGA

AAGATGAAAGGAAAGGCGTT

Otherwise guides against ROSA26 might also work as a targeting control.

Mint Incubusover 4 years ago

thanks for your sequences! However, I now made experiments without any gRNA vector, so just the dCas-KRAB vector, and got the same effects. Did anybody experience the same?

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.