pX330 repeat sequence

In the pX330 vector the sequence just downstream of the U6 terminator appears to be a repeat of the sequence just downstream of the BbsI cloning site. Specifically the following sequence appears twice:

TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT

Does the presence of this sequence downstream of the U6 promoter serve any purpose, or could I safely remove it if I want to modify the plasmid?


Login or Signup to leave a comment
Azure Unicornabout 3 years ago

this was a remnant piece of sequence from a cloning step when making pX330, so it should be safe to remove. As you could see from other vectors from Zhang lab they don't have it near U6 cassette and work well. It may be good if you keep 5+bp (near the restriction site), this could help with primer design for future cloning. Hope this may help!

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.