Primers for CRISPRa library (Calabrese)

I was hoping someone could help with which primers are used for amplifying and sequencing the XPR_502 plasmid in the CRISPRa calabrese library.

The paper says to use the P5/P7 primers, which are listed on the Addgene page for their libraries.

However the annealing site for the Reverse P7 primer annealing site (CCAATTCCCACTCCTTTCAAGACCT) doesn't appear to be in the pXPR_502 sequence. Perhaps I'm missing something - I just don't want to order the wrong primers.


Login or Signup to leave a comment
Lavender Succubusover 3 years ago

I think you are right that the reverse primer won't work. The protocol on addgene looks like copy/paste from the KO libraries. I wasn't able to find the reverse primers sequences used in the original calabrese paper. You could probably make a pretty good guess of what changes would work, but I'd also be interested to see if anyone has tried and true primers.

Lemon Mummyover 3 years ago

I contacted John Doench and got the correct primer sequence, so I'm put the information here in case it helps anyone else.

He confirmed that the P7 (reverse) primer on Addgene is not for the pXPR_502 vector which the CRISPRa libraries use. He gave me the correct annealing sequence:

TCTACTATTCTTTCCCCTGCACTGT


This just needs to be added to the flow-cell attachment sequence, Illumina primer and the index sequence(s) for the full primer. They are going to update the Addgene page with this correct primer, which should help.

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.