NGS primer barcode for lentiCRISPRv2 and kit choose


I have a question for NGS primers using Broad GPP genome-wide Brunello library (lentiCRISPRv2 one vector system). According to their protocol, they add stagger sequence on to the P5 primer and barcode sequence on to the P7 primer. The sgRNA sequence is immediately after the P5 vector primer binding sequence, and the distance between sgRNA sequence and P7 reverse primer vector binding site is 115 base. As shown below: __ __

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTsTTGTGGAAAGGACGAAACACCGATCGATCGATCGATCGATCG---115 base-- CCAATTCCCACTCCTTTCAAGACCT __ __

P5 flowcell attachment sequence, Illumina sequencing primer, Stagger region, P5 Vector primer binding sequence, sgRNA sequence, P7 vector primer binding sequence __ __

The questions I have are: __ __

  1.  If I choose 75 cycle kit, should I use Single-Read Sequencing from P5 primer to get sgRNA sequence?  __ __But it means I will lose barcode since it is 115 base from P7 to sgRNA? __ __
  2.  If I want to use Paired-End Sequencing to have barcode on P7, should I choose 150 cycle kit? __ __
  3.  Is it ok if I add barcode onto the P5 primer and stagger sequence on to the P7 primer? This way will be opposite to the Broad protocol. __ __

Login or Signup to leave a comment
Wine Trollover 3 years ago

I would really appreciate it if anyone can help me to answer my question!

Fuchsia Kelpieover 3 years ago

Please refer to screening protocol paper (Joung Nat Protocols 2017) for reference on the Illumina sequencing parameters. You will have to match our primer set and corresponding sequencing parameters to yours to double check, but I would guess that you can use your 75 cycle kit to do 85 cycles of read 1 and 8 cycles of index 1 to cover your sgRNA target sequence. The P5, P7, and Illumina sequencing primer lengths are not included in the cycle count to get to the sgRNA target sequence.

Wine Trollover 3 years ago

Thank you so much!

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.