How long the DR sequence should be for Lwa Cas13a crRNA?

ne, I want to design a RNA detect system, and for Lwa Cas13a crRNA design, I suppose I need a sequence with DR sequence + crRNA ( from 5 ends to 3 ends). From the literuatures, I found some of the design employed 36 nt sequence as the DR sequence, and some employed the DR sequence with 16 nt, if there a principle for DR sequence selection? which length would be better ?


Login or Signup to leave a comment
Lemon Lamiaover 2 years ago

I would like to help, but need a bit more information.

You said that you want to design a RNA detection system. Are you referring to methods like SHERLOCK? For that purpose you would just need to purify the crRNA in vitro, no DR needed.

If you are thinking about detecting RNA molecules in living cells, I would recommend one of the following methods (not based on Cas13): Riboglow (https://doi.org/10.1038/s41589-018-0103-7) and Pepper (https://doi.org/10.1038/s41587-019-0249-1).

I hope this helps!

Yellow Wendigoover 2 years ago

Excuse me for the missing of the informations.

Yes, I am going to using the method like SHERLOCK, and detect the target RNA in vitro. From the literature, the RNA has two parts, one is to recognize the target sequence, here I empoyed a 28 nt sequence, and another part is to holding the Cas13a protein. Now I purified the Lwa Cas13a protein, for the functional protein-RNA complex, do I need a DR sequence in 5 ends? For my understanding, crRNA is the sequence which match the target RNA, and the extra sequence at 5 ends like "GATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC" is DR sequence, both of them are necessary for forming the protein- RNA complex, is it right?

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.