Failed in reading GeckoV2 library csv while running count_spacers.py?

I just generated the Gecko V2 human sgRNA plasmid library from addgene. When I ran the count_spacers.py as

python ../Screening_Protocols_manuscript/count_spacers.py -f ZX_Gecko2_A_S1_R1_001.fastq -i human_geckov2_library_a_09mar2015.csv,

the statistics.txt looks like:

Number of perfect guide matches: 0

Number of nonperfect guide matches: 14157930

Number of reads where key was not found: 1504814

Number of reads processed: 15662744

Percentage of guides that matched perfectly: 0.0

Percentage of undetected guides: 100.0

Skew ratio of top 10% to bottom 10%: Not enough perfect matches to determine skew ratio

I think for most of reads, there is an key sequence found. So I guess it might be a wrong csv file. The csv file I downloaded from addgene looks like this:

head human_geckov2_library_a_09mar2015.csv

gene_id,UID,seq,

A1BG,HGLibA_00001,GTCGCTGAGCTCCGATTCGA,HGLibA_00076

A1BG,HGLibA_00002,ACCTGTAGTTGCCGGCGTGC,

A1BG,HGLibA_00003,CGTCAGCGTCACATTGGCCA,

A1CF,HGLibA_00004,CGCGCACTGGTCCAGCGCAC,

A1CF,HGLibA_00005,CCAAGCTATATCCTGTGCGC,

A1CF,HGLibA_00006,AAGTTGCTTGATTGCATTCT,

A2M,HGLibA_00007,CGCTTCTTAAATTCTTGGGT,

A2M,HGLibA_00008,TCACAGCGAAGGCGACACAG,

A2M,HGLibA_00009,CAAACTCCTTCATCCAAGTC,

Could you have a look?


Login or Signup to leave a comment
Beige Goblinover 2 years ago

By the way, I also tried the library csv from https://sourceforge.net/projects/mageck/files/libraries/

It's certainly the same library with different format, so I'm a little bit confused.

Beige Goblinover 2 years ago

Sorry to bother again, I think I fixed it. csv with each line corresponding only one sequence should work.

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.