Customise library design

I want to design my own custom library but I have some very basic
questions before starting:

1) How do you obtain your sgRNA? I mean, after you design the guides
is there a company that puts the two oligos together and sends to you
the guide ready to use? So you "just" have to clone it into the
plasmid (lenti guide puro in my case)?

2) You clone all the guides at once and you check with NGS if you have
a proper coverage of all the guides? (As you normally do when you
purchase Gecko or Sam libraries?) So, just to be sure, you don't clone
every guide separately, but you clone all the guides together.

3) I understood -reading all your stories- that CPEC is far better
then gibson assembly and that with this method you have obtained
enough plasmid to make your virus and infect the cells, is this
correct?

4) How do you scale your reaction from step 2 of Julia Nature
protocol? She performs 12 reactions for 100.000 guides, but Anthi says
she was doing 2 PCR for 1250 guides, can you explain to me how to
calculate the proper number?

I really appreciate your help,


Login or Signup to leave a comment
Purple Ghostabout 2 years ago

To answer your questions:

1. I ordered my oligo pool from Twist Bioscience. The format has to be like this, where sequences in green are the flanking sequences for Gecko library (a KO library) which are compatible with the primers found in Joung et al. Nat Prot 2017. In other words, if you use these flanking sequences, you can use the primers described in Nat Prot paper for the amplification of your library and for NGS (for KO libraries).

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG sgRNAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

See an older post from me here: https://groups.google.com/forum/#!searchin/crispr/julia$20joung|sort:date/crispr/CvO1yeNGCUE/L0GjqO2jAwAJ

So, you can make a list with your sequences and send it to the company to proceed with synthesis. You don't have to design two oligos, as we do when we want to individually clone a sgRNA into a vector.

2. Yes you have to clone all the guides at once. Gibson assembly didn't work for me so I proceed with CPEC method.

See this post: https://groups.google.com/forum/#!searchin/crispr/anthi$20demetriadou|sort:date/crispr/ZWJF7iw7e90/N7pc2iBnCgAJ

3. I think it's a matter of efficiency of the Gibson reaction not of quantity but I'm not sure. You can try both methods if you want and check with which will get a higher electroporation efficiency (number of colonies).

4. My library has 1250 guides, so according to the paper, for PCR amplification of the pooled oligo library I should performed 0.15 reaction if you do the maths. Since this is not feasible, let's say that I had to perform 1 reaction. I performed 2 reactions (20 cycles) to be on the safe side but after gel extraction in Step 7 I had very low concentration. So I did 4 PCR reactions and 3 reactions for the digestion of lentiGuide-puro (Step 8).

For CPEC, I performed 7 PCR reactions with insert and 5 control PCR reactions (without insert).

Terracotta Zombieabout 2 years ago

really many thanks for your answer.

I have one more regarding the design of the guide.

If I understood well, I need to design my oligo as you suggest adding the flanking sequences to my sgRNA and then amplify the sequence with the primer in table 2.

So the oligo I will order will be your 84 nucleotides of the flanking region + 20 nucleotide of the guide.

Is it correct?

Sorry for my very basic question and really many thanks again

Purple Ghostabout 2 years ago

below you can see a part of my oligo list that I sent to Twist Bioscience for oligo pool synthesis. For each gene, I have 4 different guides, so below are the oligos for 2 genes. The only thing that changes is the quide sequence (shown here as a string of X).

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT

After you receive your oligo pool from the company, you have to PCR amplify your oligo pool, as descibed in Steps 3-4 of the paper.

When I received my oligo pool, I made a stock solution of 10ng/uL and then I made a 1:10 dilution (1ng/uL) which was my working concentration for the PCR.

Use Oligo-Fwd and Oligo-Knockout-Rev primers from Table 2 for PCR amplification of the oligo pool.

Terracotta Zombieabout 2 years ago

Many thanks, very useful advice!

All the best

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.