count_spacers.py results error

there!

I ran count_spacers. py and I am keep getting wrong result.

I downloaded human Gecko library csv file from add gene

gene_id,UID,seq,

A1BG,HGLibA_00001,GTCGCTGAGCTCCGATTCGA,HGLibA_00076

A1BG,HGLibA_00002,ACCTGTAGTTGCCGGCGTGC,

A1BG,HGLibA_00003,CGTCAGCGTCACATTGGCCA,

A1CF,HGLibA_00004,CGCGCACTGGTCCAGCGCAC,

A1CF,HGLibA_00005,CCAAGCTATATCCTGTGCGC,

A1CF,HGLibA_00006,AAGTTGCTTGATTGCATTCT,

A2M,HGLibA_00007,CGCTTCTTAAATTCTTGGGT,

A2M,HGLibA_00008,TCACAGCGAAGGCGACACAG,

A2M,HGLibA_00009,CAAACTCCTTCATCCAAGTC,

A2ML1,HGLibA_00010,AAATTTCCCCTCCGTTCAGA,

A2ML1,HGLibA_00011,GCTTACCTGTAGTTCCACCA,

A2ML1,HGLibA_00012,TATTTCCAACTCCCGACACC,

A3GALT2,HGLibA_00013,CGAATGCGCGTCGCGTTCGA,

A3GALT2,HGLibA_00014,CTTCGAACGCGACGCGCATT,

A3GALT2,HGLibA_00015,CGGCAGATCCTACTTACACT,

A4GALT,HGLibA_00016,CAGTCCCGCTACGTCCTCAA,

A4GALT,HGLibA_00017,CTACTGCCCCACGACGCACG,

A4GALT,HGLibA_00018,CTTTGAGGACATCAACCCCG,

A4GNT,HGLibA_00019,CAGCTCGGATGCATCCCGCC,

A4GNT,HGLibA_00020,GTAGCGCCTCCACTCTCGAT,

==

I get

Number of perfect guide matches: 5

Number of nonperfect guide matches: 3

Number of reads where key was not found: 47738357

Number of reads processed: 47738365

Percentage of guides that matched perfectly: 62.5

Percentage of undetected guides: 100.0

Skew ratio of top 10% to bottom 10%: Not enough perfect matches to determine skew ratio

i don't think my spacer csv and my NGS.fastq are unmatched..

Will I need to adjust key region on spacer.py?


Login or Signup to leave a comment
Pink Sirenabout 1 year ago

I solved this issue by deleting gene_ID and UID columns and only keep the column with guide sequences as the reference library_sequences file.

Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.