Methods

Optimized Cas9 expression improves performance of large-scale CRISPR screening

Cell culture

MCF10A, SW480, A375 and HEK293T cell lines were obtained from ATCC. MCF10A cells were cultured in DMEM/F-12 medium containing 2.5 mM L-glutamine and 15 mM HEPES, supplemented with 5% horse serum, 10 µg/mL insulin, 0.5 µg/mL hydrocortisone and 0.1 µg/mL cholera toxin. SW480 cells were cultured in RPMI medium; A375 and HEK293T cells were cultured in DMEM medium. All the media were supplemented with 10% FBS, 1% penicillin/streptomycin and 2□mM L-glutamine. All cell lines were cultured at 37°C and with 5% CO2. All cell lines were validated by STR profiling and mycoplasma tests were performed every 2-3 months.

Western blots

After the indicated culture period, cells were washed with chilled PBS, then lysed with RIPA buffer (25mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) containing Complete Protease Inhibitor cocktail (Roche) and phosphatase inhibitor cocktails II and III (Sigma). Samples were then centrifuged for 10 min at 15,000 x g at 4°C and supernatant was collected. Protein concentration of the samples was normalized after performing a Bicinchoninic Acid (BCA) assay (Pierce BCA, Thermo Scientific), according to the manufacturer’s instructions. Protein samples (denatured with DTT followed by 5 min heating at 95°C) were then loaded in a 4-12% polyacrylamide gel. Gels were run (SDS-PAGE) for approximately 45 min at 175 volts. Proteins were transferred from the gel to a polyvinylidene fluoride (PVDF) membrane at 330 mA for 90 min. After the transfer, membranes were incubated in blocking solution (5% bovine serum albumin (BSA) in PBS with 0.1% Tween-20 (PBS-T)). Subsequently, membranes were probed with primary antibody in blocking solution (1:1000) overnight at 4°C. Membranes were then washed 3 times for 10 min with PBS-T, followed by 1 h incubation at room temperature with the secondary antibody (HRP conjugated, 1:10,000) in blocking solution. Membranes were again washed 3 times for 10 min in PBS-T. Finally, a chemiluminescence substrate (ECL, Bio-Rad) was added to the membranes and signal imaged using the ChemiDoc-Touch (Bio-Rad).

Generation of Cas9-expressing cancer cell lines

MCF10A cells were transduced with a lentivirus containing Edit-R Inducible Cas9 (Horizon CAS11229) at approximately 40% confluence in the presence of polybrene (4 μg/mL). Cells were incubated overnight, followed by replacement of the lentivirus-containing medium with fresh medium containing Blasticidin (10 μg/mL). After selection, several single cell clones were generated and Cas9 expression was assessed by Western blot. A clone with high Cas9 expression upon doxycycline treatment, and undetectable Cas9 expression in the absence of doxycycline, (named “MCF10A_iCas9”) was used for subsequent experiments.

SW480 cells were transduced with Lenti-iCas9-neo (Addgene 85400) at approximately 60% confluence in the presence of polybrene (8 μg/mL). Cells were incubated overnight, followed by replacement of the lentivirus-containing medium with fresh medium containing G418 (100 μg/mL). After selection was completed, a titration of doxycycline (1 to 1000 ng/mL) was performed and the induction of Cas9 expression was assessed by flow cytometry. We determined that 10, 40 and 1000 ng/mL of doxycycline induced low, medium and high levels of Cas9 expression, respectively. Cas9 expression levels were confirmed by Western blot and flow cytometry one week later. The Cas9-expressing cell line was named “SW480_iCas9”.

SW480, A375 and HEK293T cells were transduced with lentiCas9-EGFP (Addgene 63592) at approximately 40-60% confluence in the presence of polybrene (8 μg/mL). Cells were incubated overnight, followed by replacement of the lentivirus-containing medium with fresh medium. After 1 week in culture cells were sorted on low, medium and high GFP levels (BD FACSAria™ Fusion Cell Sorter). Cas9 expression levels were confirmed by Western blot and flow cytometry one week later. The Cas9-expressing cells were named according to their cell line name and Cas9 expression level, i.e. “name__Cas9_expression level”.

Editing efficiency assessment by flow cytometry and TIDE analysis

Parental and Cas9-expressing cell lines, as indicated, were transduced with pXPR_011 (Addgene, 59702) at approximately 40-60% confluence in the presence of polybrene (8 μg/mL). Cells were incubated overnight, followed by replacement of the lentivirus-containing medium with fresh medium containing puromycin (2 μg/mL). Cells were harvested 20 h, 3 days (SW480), 6 days and 10 days (HEK293T and A375) after transduction with pXPR_011, GFP levels were assessed by flow cytometry (BD LSRFortessa) and analyzed using FlowJo 10. pXPR_011 results in the expression of both GFP and a sgRNA targeting GFP in the transduced cells. Therefore, editing efficiency can be (indirectly) assessed by analyzing the reduction in GFP signal over time.

SW480_iCas9 cells were transduced with 3 different sgRNAs cloned into pU6-sgRNA-EF1-Puro-T2A-GFP (see sgRNA cloning section below) at approximately 60% confluence in the presence of polybrene (8 μg/mL). Cells were incubated overnight, followed by replacement of the lentivirus-containing medium with fresh medium containing puromycin (2 μg/mL). Cells were kept in puromycin for 7 days. At day 7, a fraction of the cells was harvested, another fraction was analyzed by flow cytometry to confirm equal infection efficiencies indicating similar sgRNA expression levels, and the rest of the cells were placed back in culture and treated with either 10 ng/mL or 1 µg/mL doxycycline. Cells were harvested from these two induction arms after 2, 4, 8, 12, 16, (20, 24 and 32 – only for sgRNA 3) days in continuous culture with doxycycline. DNA was isolated from all samples, Sanger sequencing was performed and editing efficiency was analyzed using TIDE (https://tide.nki.nl/). At day 13, cells were also harvested for western blot and flow cytometry analysis, to assess Cas9 expression levels.

sgRNA cloning

To generate OR9Q2 (non-essential gene) sgRNA-expressing MCF10A cells, we cloned OR9Q2 sgRNA (5’-ATAACCGAGAAGGCCCGCTG-3’) sequence into lentiCRISPRv2 (Addgene, #52961) and lentiGuide-Puro (Addgene, #52963). Backbones were digested with BsmBI and cloned using Gibson assembly. sgRNAs targeting 3 different locations in the genome were cloned into a modified version of pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955), where BFP was replaced by superfolder GFP (sfGFP) – named “pU6-sgRNA-EF1-Puro-T2A-GFP”. Puro-T2A-BFP was removed using NheI and EcoRI sites. To introduce Puro-T2A-sfGFP, we amplified Puro-T2A as well as sfGFP, adding homology arms to both PCR products. Puromycin-T2A was amplified using the following oligos: FW: 5’- GTTTTTTTCTTCCATTTCAGGTGTCGTGAGCTAGCCCACCATGACCGAGTACAA GCCCAC-3’, RV: 5’- AACTCCAGTGAAAAGTTCTTCTCCTTTGCTGGTGGCGACCGGTGGGCCAGGAT TCTCCTC-3’ sfGFP was amplified using the following oligos: FW: 5’- GAGGAGAATCCTGGCCCACCGGTCGCCACCAGCAAAGGAGAAGAACTTTTCAC TGGAGTT-3’ RV: 5’- ATGTATGCTATACGAAGTTATTAGGTCCCTCGACGAATTCTTATTTGTAGAGCTC ATCCA-3’

The resulting PCR products were inserted into the open sgRNA vector backbone through Gibson Assembly. To introduce the custom designed sgRNA sequences into the pU6-sgRNA-EF1-Puro-T2A-GFP vector, the vector was digested using BstXI and BamHI. The sgRNAs were PCR-amplified using sgRNA-specific forward primers and a universal reverse primer: FW_1: 5’- TTGGAGAACCACCTTGTTGGAATATGTTTAAGCCTAGAGAGTTTAAGAGCTAAG CTGGAA, FW_2: 5’- TTGGAGAACCACCTTGTTGGTATAGGATAATAGCTGGAAGGTTTAAGAGCTAAG CTGGAA, FW_3: 5’- TTGGAGAACCACCTTGTTGGAGAGGTCTAATTCTAGGGCCGTTTAAGAGCTAAG CTGGAA, RV: 5’- GTAATACGGTTATCCACGCGGCCGCCTAATGGATCCTAGTACTCGAGA. The resulting PCR products were isolated and used for Gibson Assembly.

Generation of custom sgRNA library

For the design of the custom sgRNA library targeting essential genes and safe-havens we used the Broad GPP sgRNA design portal and the safe-havens as designed previously (15). The sgRNA sequences (Supplemental Table 2) were ordered as a pool of oligonucleotides (Agilent) with flanking sequences to enable PCR amplification and Gibson assembly into pLentiGuide-Puro (pLG, addgene #52963). The pooled oligo library was amplified using pLG_U6_foward 5’- GGCTTTATATATCTTGTGGAAAGGACGAAACACCG-3’ and pLG-TRACR_Reverse 5’-GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’. The fragments were purified and cloned into pLG as described by Morgens (16). The representation of the custom sgRNA library was validated by next generation sequencing.

sgRNA libraries and screens

Two different versions of the Brunello library were used – a “1 vector system” (backbone expresses both Cas9 and the library – Addgene, 73179) and a “2 vector system” (backbone expresses only the library – Addgene, 73178). In this study we also used our Essential/Safe-havens library described above.

The appropriate number of cells to achieve 250-fold representation of the library, multiplied by five to account for 20% transduction efficiency, were transduced at approximately 40-60% confluence in the presence of polybrene (4-8 μg/mL) with the appropriate volume of the lentiviral-packaged sgRNA library. Cells were incubated overnight, followed by replacement of the lentivirus-containing medium with fresh medium containing puromycin (2-4 μg/mL). The lentivirus volume to achieve a MOI of 0.2, as well as the puromycin concentration to achieve a complete selection in 3 days was previously determined for each cell line. Transductions were performed in triplicate (technical for negative selection screens and biological for positive selection screens). After puromycin selection, cells were split into the indicated arms (for each arm, the appropriate number of cells to keep a 250-fold representation of the library was plated at approximately 10-20% confluence) and a T0 (reference) time point was harvested. Cells were maintained as indicated. In case a passage was required, cells were reseeded at the appropriate number to keep at least a 500-fold representation of the library. Cells (enough to keep at least a 500-fold representation of the library, to account for losses during DNA extraction) were collected when indicated, washed with PBS, pelleted and stored at -80°C until DNA extraction.

DNA extraction, PCR amplification and Illumina sequencing

Genomic DNA (gDNA) was extracted (Zymo Research, D3024) from cell pellets according to the manufacturer’s instructions. For every sample, gDNA was quantified and the necessary DNA to maintain a 250-fold representation of the library was used for subsequent procedures (for this we assumed that each cell contains 6.6 pg genomic DNA). Each sample was divided over 50 μl PCR reactions (using a maximum of 1 µg gDNA per reaction) using barcoded forward primers to be able to deconvolute multiplexed samples after next generation sequencing (for primers and barcodes used, see Supplementary Table 3). PCR mixture per reaction: 10 μl 5x HF Buffer, 1 μl 10 μM forward primer, 1 μl 10 μM reverse primer, 0.5 μl Phusion polymerase (Thermo Fisher, F-530XL), 1 μl 10mM dNTPs, adding H2O and template to 50 μl. Cycling conditions: 30 sec at 98°C, 20× (30 sec at 98°C, 30 sec at 60°C, 1 min at 72°C), 5 min at 72 °C. The products of all reactions from the same sample were pooled and 2 μl of this pool was used in a subsequent PCR reaction using primers containing adapters for next generation sequencing (Supplementary Table 2). The same cycling protocol was used, this time for 15 cycles. Next, PCR products were purified using the ISOLATE II PCR and Gel Kit (Bioline, BIO-52060) according to the manufacturer’s instructions. DNA concentrations were measured and, based on this, samples were equimolarly pooled and subjected to Illumina next generation sequencing (HiSeq 2500 High Output Mode, Single-Read, 65 bp). Mapped read-counts were subsequently used as input for the further analyses.

Bioinformatics Analysis

For each CRISPR screen the sgRNA count data for each sample was normalized for sequence depth using the method described by DESeq23 with the difference that the total value instead of the median of a sample was used. Because of the composition of the sgRNA library with a large fraction of sgRNAs targeting essential genes, the T1 samples were corrected by dividing with the median of T1/T0 ratios for the population of non-essential sgRNAs. For the genome-wide CRISPR screen comparing the efficiency of the 1-step and 2-step systems, a differential analysis was performed using DESeq2 (17). The output was sorted on the DESeq2 test statistic with the most depleted sgRNA at the top. We then used MAGeCK Robust Rank Algorithm to determine enrichment of sgRNAs targeting each gene (18). For the ROC curves in supplemental Fig. 1B and 1C the output of these two analyses were filtered for 50 positive and 50 negative controls genes as described by Evers and colleagues (8). The Comparisons of the distribution of different groups of sgRNAs were performed using the Wilcoxon test.

Reagents

Primary antibodies: Tubulin (Sigma, T9026) and Cas9 (Cell Signaling, 14697). Secondary antibody: Goat Anti-Mouse IgG (H + L)-HRP Conjugate (BioRad, 1706516).

Article TitleOptimized Cas9 expression improves performance of large-scale CRISPR screening

Abstract

CRISPR technology is an invaluable tool for large-scale functional genomic screening. Genome editing efficiency and timing are important parameters impacting the performance of pooled CRISPR screens. Here we show that by optimizing Cas9 expression levels, the time necessary for gene editing can be reduced contributing to improved performance of CRISPR based screening.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.