Materials and methods

CRISPR/Cas9 targeting of MCPyV T antigen in Merkel tumors

sgRNA design

13 gRNAs were designed to target the small and large Tumor antigen genes of MCPyV. Three CRISPR design tools: Broad institute software (broadinstitute.org/gpp/public/analysis-tools/sgrna-design), CRISPR-MIT (http://crispr.mit.edu) and CRISPOR were used. MKL-1 (Genbank Accession #: FJ173815.1) and MS-1 (Genbank Accession #: JX045709.1) MCPyV sequences were used as target DNA sequences. gRNAs with highest specificity score and with lowest possible off targets were selected. Synthetic gRNA oligonucleotides were cloned into pLentiCRISPRv2 (Addgene #52961) at BsmBI (# R0580S, NEB) restriction sites. Plasmid DNA was prepared using Stbl3 competent cells (#C7373-03, Invitrogen) and Qiagen midi prep kits (#12143).

Synthesis of sgRNAs using IVT

Two oligonucleotides were designed as DNA templates, per gRNA, for in vitro transcription (IVT). Forward oligo for Cas9 gRNA synthesis consisted of the T7 promoter (TAATACGACTCACTATAGG), guide RNA, and start of Cas9 gRNA scaffold. Reverse oligo consisted of complete gRNA scaffold with complementarity to 15nt in the forward oligo (shown below). Three G’s were added at the gRNA start for efficient T7 transcription.

Target substrate for C3 gRNA in vitro cleavage (TARGET / pam):

5’ GATGAAAGCTGCTTTCAAAAGAAGCTGCTTAAAGCATCACCCTGATAAAGgggGAAATCCTGTTAT 3’

crRNA oligo for C3 gRNA in vitro transcription (T7 / ADDED G / GUIDE / SCAFFOLD):

Forward primer: TAATACGACTCACTATAGGGAAAGCATCACCCTGATAAAGGTTTTAGAGCTAGAA Reverse primer: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAA CTTGCTATTTCTAGCTCTAAAAC

Target substrate for C13 in vitro cleavage (TARGET / pam):

5’ CCAGTGTACCTAGAAATTCTTCCAGAACGGATGGCACCTgggAGGATCTCTTCTGCGATGAATC 3’

crRNA oligo for C13 gRNA in vitro transcription (T7 / ADDED G / GUIDE / SCAFFOLD):

Forward primer: TAATACGACTCACTATAGGGTTCCAGAACGGATGGCACCTGTTTTAGAGCTAGAA Reverse primer: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAA CTTGCTATTTCTAGCTCTAAAAC

Templates for IVT were amplified by the following PCR reaction: Denaturation at 95°C for 3 mins followed by 30 cycles of 95°C – 30s, 45°C – 30s and 72°C for 30s and final annealing at 72°C for 7 min. The PCR products were cleaned up using PCR clean up kit (# A9282, Promega). sgRNAs were synthesized using the MEGAShortScript™ Kit (# AM1354, Invitrogen) following the manufacturer’s protocol with 2ug PCR product template over night at 37°C. The RNA was treated with 1ul of DNase TURBO for 15 minutes followed by purification using the MEGAclear Transcription Clean-Up Kit (# AM1908, Invitrogen).

In vitro cleavage assay

In vitro cleavage reaction was performed with purified SpCas9 protein (500ng) (Kind gift from Dr. Praveen Vemula’s Laboratory) at 37°C in cleavage buffer consisting of 20 mM HEPES (pH 7.5), 150 mM KCl, 10 mM MgCl2, 1% glycerol and 0.5mM DTT for 1 hour. 300 ng of sgRNA and 200 ng of the target DNA were used for the reaction. PCR amplicons of sT and LT gene regions from plasmid RAZ1 (Addgene #114381) were used as target DNA templates (Refer Supplementary Table 1 for primers). The PCR amplicon was purified using Ampure beads (#A63881, Beckman Coulter) as per manufacturer’s protocol. The IVC reactions were stopped by treatment with 2ul of Proteinase K (10mg/ml) at 55°C for 30 minute. 1x gel loading dye was added to the reactions and samples were run on 2% agarose gels (# RM273, HIMEDIA).

  • View inline
  • View popup

Supplementary Table 1.Primers Used

Plasmid Construction

We cloned the NCCR and T antigen derived from MKL-1 into a pLentiCMV backbone vector We used the target region PCR amplicon as the DNA substrate.

Gibson Cloning the gRNAs in pDECKO mCherry

For expressing the gRNAs in MCPyV positive cell lines, C3 and C13 were cloned into pDECKO mCherry lentiviral plasmid using Gibson assembly. The backbone plasmid (kind gift of Dr. Debjyoti Chakroborty, IGIB) was digested using BsmBI at 55°C for 2 hours. The cut plasmid was run on a 0.8% agarose gel and the linear band was gel extracted. The oligonucleotides for insert 1 consisting of the gRNAs, T7 and part of H1 promoter and gRNA scaffold were designed using http://crispeta.crg.eu. Insert 1 was cloned into digested vector and was transformed into Stbl 3 competent cells. Positive clones were selected using colony PCR followed by plasmid isolation. This intermediate plasmid was again digested by BsmB1. The constant insert 2 consisting of remaining part of gRNA 1 scaffold and H1 promoter was PCR amplified from the complete pDECKO plasmid and was cloned into the intermediate plasmid. The reaction was transformed in Stbl 3 competent cells. Positive clones were validated using colony PCR and sequencing.

Cell culture conditions

HEK 293T cells were obtained from ATCC and grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS) 1X Penicillin/Streptomycin (Pen Strep, catalog # 15140122). Merkel Cell Carcinoma cell lines, MKL-1 were obtained from ECACC (#09111801) and cultured in Roswell Park Memorial Institute (RPMI) Media with 10% FBS and 1X Penicillin/Streptomycin. The cells were grown at 37°C with 5% CO2.

Lentiviral vector construction and transduction

Lentiviral vectors were constructed by co-transfecting HEK 293 T cells with plasmid of interest, the Gag-Pol packaging plasmid psPAX2 (Addgene #12259), and pVSVG (Addgene #8454) expressing plasmid in a ratio of 5:3.75:1.25. Lipofectamine® LTX (Invitrogen #15338100) was used in 3:1 ratio with the total amount of DNA to be transfected. DNA, Lipofectamine LTX (Invitrogen #15338500) and OptiMEM mix were incubated at RT for 20 minutes and added to cells in antibiotics free media. Viral media was collected 48h and 72h post transfection. The viral media was filtered through 0.45 μm filter followed by concentration through Amicon column and addition of 1/3rd volume of LentiX Concentrator (Takara #631231). Viral pellet was obtained by spin down at 1500g at 4°C, resuspended in RPMI media and added to the MKL-1 cells to be transduced. Screening of gRNAs was done by transducing pLentiCRISPRv2 plasmid containing the gRNAs in MKL-1 cells followed by puromycin (1μg/mL) selection. pLentiCRISPRv2 (Addgene #52961) without gRNA was used for mock transduction. For constructing MKL-1 pDECKO mCherry C3+C13 cell line, MKL-1 cells were transduced with pDECKO mCherry C3+C13 plasmid. pDECKO mCherry empty vector (EV; without gRNAs) was used as an empty vector for mock transduction. MKL-1 Cas9 cell line was developed using pCWCas9 Blast (Addgene #83481) with Blasticidin (10ug/mL) selection for 10 days post transduction. Cas9 was expressed by 1ug/ml of Doxycycline induction.

Western blot analysis

Cells were lysed in EBC buffer (50 mM Tris pH-8, 150 mM NaCl, 0.5mM EDTA, β mercaptoethanol-1:10,000, 0.5% NP-40, 1 mM PMSF supplemented with protease inhibitor cocktail (Roche, Cat #118575). Protein lysate was quantitated using Pierce BCA protein assay kit. The lysate was denatured in 1x Laemmli buffer by boiling at 99°C for 5 minutes. The proteins were separated using SDS-PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane (#88518, Biorad) The PVDF membrane was blocked with 5% Blotto (SC-2325, Santacruz) in 1X TBS-T. The blot was developed with primary antibodies overnight at 4°C a s follows: anti-MCPyV Tumor antigen monoclonal antibody (1:5000;Ab3 and Ab5 were used (put citation)), anti-Cas9 monoclonal antibody (1:1000; Cell signaling #14697), and anti-Vinculin monoclonal antibody (1:10000; Sigma #V9131). The PVDF membrane was incubated in peroxidase-labeled secondary antibodies. The ECL™ Prime Western Blotting System (#RPN2232, GE Healthcare) was used for the detection of chemiluminescence according to the manufacturer’s protocol. The chemiluminescence was detected using ImageQuant™ Las 4000 (GE Healthcare).

Article TitleCRISPR/Cas9 targeting of MCPyV T antigen in Merkel tumors

Abstract

Merkel cell carcinoma (MCC) is a rare, aggressive skin cancer caused either by Merkel cell polyomavirus (MCPyV) T antigen gene expression, post integration (∼80% cases), or by UV mediated DNA damage. Viral-positive Merkel tumors are not only caused by but also oncogenically addicted to tumor antigen expression. In this study we used CRISPR-Cas9 based gene-editing to develop a potential therapeutic tool for MCPyV positive MCC. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas system is a genome editing technology whereby a guide RNA (gRNA) molecule, targets a Cas endonuclease to a specific genomic site, using sequence homology, and induces a double strand break. To target MCPyV T antigens, we designed a strategy using 2 gRNAs targeting the T antigen genomic region that would cut off a substantial portion of the gene thereby rendering it dysfunctional. We validated the MCPYV T antigen targeting efficiency of our gRNAs, both individually and together by in vitro cleavage assays. Finally, to translate this finding, we delivered this CRISPR system in patient-derived MCC cell lines and show reduction in T antigen gene expression. Our proof-of-concept study shows that 2 MCPyV targeting CRISPR/Cas gRNAs in combination can knock out MCPyV T antigen, thus, being of therapeutic importance. We hope that this CRISPR system can be potentially delivered in vivo for advancing MCPyV positive MCC treatment in the future.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.