Materials and Methods

Antiviral activity of chitosan nanoparticles for controlling plant-infecting viruses
antivirus Bean yellow mosaic virus (BYMV) Chitosan NanoparticlesCRISPR faba bean GenomicsGenomicsGenomics PR-1 gene regulation

Virus isolation and propagation

Faba bean plant samples with Bean yellow mosaic virus-like symptoms were collected from local faba bean fields in the Giza governorate, Egypt, during the 2017/2018 growing season. Leaf samples were initially tested using the double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) technique as described by Clark and Adams21 using specific polyclonal antibodies against BYMV (EPHYRA Bioscience Inc., Ontario, Canada). The reactions were assessed at 405 nm in a microplate reader (Bio-Tek, USA). Samples that tested positive against BYMV were used as sources of virus inoculum. The virus was isolated through single local lesion inoculations on Chenopodium amaranticolor indicator plants.22 Ten-day-old plants were mechanically inoculated with the BYMV crude sap using 0.01 M phosphate buffer pH 7.1, (1:10), 0.01% Na2SO3 and carborundum (600 mesh) and kept under insect-proof greenhouse conditions until symptoms developed. The isolated source was propagated on 10-day-old faba bean plants (cv. Giza 843) and was used as inoculum for further studies.

Molecular identification of the isolated virus

Total RNA was isolated from both healthy and symptomatic faba bean leaves using RNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. Reverse transcription (RT)-PCR reaction was optimised using the One-Step RT-PCR system (Thermo Fisher, USA). A specific primer pair, BYMV-CPU (5´ GTCGATTTCAATCCGAACAAG 3´) and BYMV-CPD (5´ GGAGGTGAAACCTCACTAATAC 3´), was used to target the CP gene region to amplify a 907-bp fragment of the BYMV genome.23 The one-step RT-PCR reaction was performed by combining 25 μL One-Step PCR Master Mix, 1 μL of each primer pair (200 nM), 2.5 μL of RT-enzyme enhancer, 1 μL verso enzyme mix, and 3 ng of RNA template, and the mixture was made up to 50 μL using nuclease-free water. The amplification reaction was automated in a T-Gradient thermal cycler (Biometra, Germany) with an initial reverse transcription process at 50 °C for 15 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 50 °C for 1 min and extension at 72 °C for 2 min, with a final additional extension step for 10 min at 72°C. The PCR products were electrophoresed on 1% agarose gel in 0.5 x TAE buffer, then visualised with a Gel Doc system (2000, Bio-Rad, USA).

Preparation of chitosan nanoparticles

A chitosan nanoparticle solution was chemically prepared by reduction of low molecular weight chitosan (Sigma, Egypt) based on the ion-gelation method using sodium tripolyphosphate as a reducing agent.24 Chitosan powder (0.5 mg/mL) was dissolved in 1% acetic acid in deionised distilled water and left under vigorous stirring for 30 min. Sodium tripolyphosphate was dissolved separately in deionised distilled water (0.7 mg/mL). Chitosan nanoparticles were formed by mixing 500 mL of chitosan with increasing amounts of sodium tripolyphosphate solution (160 mL) under continuous stirring for 1 h. The synthesised chitosan nanoparticles (ChiNPs) were subjected to further physicochemical characterisation.

Physicochemical characterisation of ChiNPs

Dynamic light scattering analysis

The particle size distribution and zeta potential of constructed ChiNPs were assessed using a Zetasizer (Malvern, ZS Nano, UK). The colloidal chitosan nanoparticle solution was diluted with distilled water and put into a disposable cuvette for analysis.

X-ray diffraction

The physicochemical crystalline nature of ChiNPs was confirmed using an X-ray diffractometer (X‘pert PRO, PAN analytical, Netherlands) operated with a CuK radiation tube (= 1.54 A˚) at 40 kV. The ChiNP solution was centrifuged at 20 000 x g for 30 min at 4 °C for powder phase yield, the precipitated ChiNPs were dried, then bombarded by X-ray for phase analysis.25

Surface morphology

Particle size and the actual shape of ChiNPs were determined by high-resolution transmission electron microscope (Tecnai G2, FEI, Netherlands) under an accelerating voltage of 200 kV.

Effect of ChiNPs on virus infectivity

Treatments

Foliar applications were carried out under an insect-proof greenhouse using six concentrations of chitosan and ChiNPs (50, 100, 200, 250, 300 and 400 mg/L). Ten-day-old faba bean plants (five plants/pot) were mechanically inoculated with BYMV- infected plant sap. The inoculated plants were uniformly sprayed until runoff with all tested dosage rates (48 h post-viral challenge). Water-treated plants served as a comparable control. Each experimental group had four replicates.

Disease assessment

Virus infectivity was determined 3 weeks post-inoculation on all treated and untreated faba bean plants using the assessment of disease incidence and severity response. Disease severity and symptom response were also assessed using a numerical scale of grades 0–4, where 0=no visible symptom apparent; 1=mild chlorotic patterns; 2=mosaic patterns and dark green vein banding; 3=mosaic patterns, leaf distortion, and reduction in leaf size; 4=severe mosaic and stunting of the whole plant. Values of disease severity were estimated by the following formula26:

Transmission electron microscope

For electron microscopic examination of virus particles, the leaf-dip preparation method was performed on the faba bean plants treated with 400 mg/L of ChiNPs and untreated controls 5 days post-treatment. Briefly, the leaf samples of both treated and untreated plants were washed, a small disc was prepared (1.5 cm in diameter) and resuspended in deionised water to remove any surface-ChiNPs attached to the leaf samples. The samples were ground in a drop of phosphate buffer pH 7.5 and 0.01% Na2SO3. Leaf extracts (10 μL) were individually loaded on carbon-coated grids for 5 min, washed with distilled water and negatively stained with 2% uranyl acetate. The grids were examined using a JEOL JEM1400 transmission electron microscope (JEOL Co., Tokyo, Japan).

Determination of virus accumulation content

Newly emerged small leaves were collected 30 days post-inoculation to detect the BYMV accumulation and to further confirm the virus replication inhibition rate using the DAS-ELISA method.21 The virus titre reactions were quantified at 405 nm in a microplate reader (BioTek, USA). Samples were considered positive when optical density (OD)-405 values were two times higher than the mean of the healthy control. The reduction percentage in virus accumulation was measured as follows:

Enzyme activity assays

Fresh leaves (0.2 g) from all treated and untreated plants were collected at 0, 24, 48, 72, 96, 120, and 144 h post-ChiNP spraying. The polyphenol oxidase antioxidant enzyme activity was determined using the methods described by Kar and Mishra.28 Change in activity was expressed as nmol of guaiacol per mg protein per min. Phenylalanine ammonia lyase activity was measured according to Lisker et al.29 Values are expressed as nmol of cinnamic acid/gfw/s. All experiments were performed in triplicate.

Pathogenesis-related (PR-1) gene expression analysis

Total RNA isolation

Leaf samples from ChiNP-treated and untreated control plants were collected 48 h post-treatment for total RNA isolation. The total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen) protocol.

cDNA synthesis

The harvested RNA (2 µg) was primed with Oligo (dT) and converted into the first-strand cDNA using COSMO cDNA synthesis kit (Willowfort, UK) according to the manufacturer’s protocol. The cDNA synthesis reaction was performed in a T-Gradient thermal cycler with initial annealing at 25 °C for 10 min, followed by an extension phase at 45 °C for 15 min.

Primers used

Gene-specific primers encoding pathogenesis-related protein 1 (PR-1 forward 5′-GGGCAGTGGTGACATAACAGGAA-3′) upstream and (PR-1 reverse 5′-CATCCAACCCGAACCGAAT-3′) downstream were designed.30 A specific primer pair of the elongation factor 1-alpha gene ELF1A/forward (5′-GTGAAGCCCGGTATGCTTGT-3′) and ELF1A/reverse (5′-CTTGAGATCCTTGACTGCAA CATT-3′) was used as an endogenous reference gene.

qRT-PCR analysis

The HERA SYBR Green qPCR kit (Willowfort, UK) was used for qRT-PCR analysis with a 20-μL reaction mixture consisting of 10 μL SYBR green master mix, nuclease-free water (7.2 μL), diluted cDNA template (2 μL) and 0.5 μL of each primer pair. The qRT-PCR programme was as follows: 95 °C for 2 min, followed by 40 cycles at 95 °C for 1 min and 60 °C for 30 s. The reaction was normalised with melting curve analysis at 65 °C for 10 s for 61 cycles. The changes in gene expression were calculated based on the internal reference gene using the 2-ΔΔCt method.31 Each experiment was conducted in triplicate.

Determination of total phenolic content

The total polyphenol dynamic curve was determined following the Folin–Ciocalteu’s reagent according to the methods described by Lin and Tang32 with slight modifications. Briefly, the collected leaf samples (0.5 g) were vigorously homogenised in 10 mL absolute ethanol. The leaf extract solution (100 µL) was transferred in a test tube containing 4 mL distilled water and 1 mL of Folin–Ciocalteu’s reagent. After 5 min, 1 mL of sodium bicarbonate (10%) and 1 mL of ethanolamine were added to the mixture. The tubes were shaken and left for 1 h in the dark at room temperature. The samples were electro-optically measured at 740 nm. A standard calibration curve for total phenol was established using gallic acid (0– 200 ppm). The results were expressed as mg of gallic acid equivalents/gram fresh weight (gfw).

Effects on plant growth and vegetation parameters

Vegetation and growth parameters (i.e. leaf area, shoot length and chlorophyll content) of treated and untreated faba bean plants were determined at the end of the experiment. Leaf area was estimated following the estimation model proposed by Chahit33. For each tested concentration, 20 leaflets of all treated plants were measured. The maximum length of the leaflet was excised from petiole to the tip along the mid-vein, while the width was obtained by measuring the area between two leaflet margins perpendicular to the mid-vein. The leaf area was estimated by:

LA (cm2) = -1.6923 + (L×0.0161) + (W×0.0929) + (0.062×L×W)

where LA is leaf area in cm2, L is leaflet length (cm), and W is the leaflet width (cm).

Changes in chlorophyll content were automatically assessed using a portable chlorophyll meter (SPAD-502 Plus, Minolta UK) and the obtained results were expressed as a chlorophyll content index. Leaflets from all treated and untreated plants were assessed and chlorophyll index values were obtained for all tested concentrations. Finally, shoot length (in cm) was also measured for all treated and untreated plants from the soil line to the top of the plant using a portable chlorophyll meter (SPAD-502 Plus, Minolta UK) and the obtained results were expressed as a chlorophyll content index. Leaflets from all treated and untreated plants were assessed and chlorophyll index values were obtained for all tested concentrations. Finally, shoot length (in cm) was also measured for all treated and untreated plants from the soil line to the top of the plant using a one-metre tape measure.

Statistical analysis

Data were statistically analysed using a completely randomised design for analysis of variance (ANOVA). Statistical analysis of the data was performed with the Assistat-Statistics Software (version 7.7 beta).34 The significant differences in each treatment group were determined at p = 0.05. Each experiment was performed in triplicate.

Article TitleAntiviral activity of chitosan nanoparticles for controlling plant-infecting viruses

Published
January 27, 2022
License

Abstract

Chitosan nanoparticles (ChiNPs) are a potentially effective means for controlling numerous plant diseases. This study firstly describes the antiviral capabilities of ChiNPs to control plant viral diseases compared to its bulk form. Bean yellow mosaic virus (BYMV) was used as a model plant virus affecting faba bean plants and many other legumes. The antiviral effectiveness of ChiNPs and chitosan were evaluated as a curative application method, using six dosage rates (50, 100, 200, 250, 300 and 400 mg/L). Results indicated that ChiNPs curatively applied 48 h post virus inoculation entirely inhibit the disease infectivity and viral accumulation content at 300 mg/L and 400 mg/L. The virus titre was greatly alleviated within the plant tissues by 7.71% up to100% depending on ChiNP dosage rates. However, chitosan used in its bulk-based material form revealed a relatively low to an intermediate reduction in virus infectivity by 6.67% up to 48.86%. Interestingly, ChiNPs affect the virus particle’s integrity by producing defective and incomplete BYMV viral particles, defeating their replication and accumulation content within the plant tissues. Simultaneously, ChiNP applications were appreciably shown to promote the pathogenesis-related (PR-1) gene and other defence-related factors. The mRNA of the PR-1 gene was markedly accumulated in treated plants, reaching its maximum at 400 mg/L with 16.22-fold relative expression change over the untreated control. Further, the total phenol dynamic curve was remarkably promoted for 30 days in response to ChiNP application, as compared to the untreated control. Our results provide the first report that chitosan-based nanomaterials have a superior effect in controlling plant viruses as an antiviral curing agent, suggesting that they may feasibly be involved in viral disease management strategies under field conditions without serious health concerns and environmental costs.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.