Materials and Methods

Combined fluorescent seed selection and multiplex CRISPR/Cas9 assembly for fast generation of multiple Arabidopsis mutants

Plant growth and transformation

In all experiments Arabidopsis thaliana Columbia (Col-0)ecotype was used. The seedlings were germinated on solid half-strength Murashige and Skoog (MS) medium without addition of sucrose. CUC1 (At3g15170), CUC2 (At5g53950) and SGN3 (AT4G20140) genes were chosen as targets for CRISPR/Cas9 targeting. The seeds of T1 and T2 generations were surface sterilized, sown on plates, incubated for 2 days at 4°C for stratification, and grown vertically in growth chambers at 22°C, under continuous light. The phenotypic analyses were performed on 6-day-old seedlings. For Agrobacterium-mediated transformation, siliques of flowering plants were removed and a solution of resuspended Agrobacterium cells carrying corresponding CRISPR constructs with sucrose and SILWETT (5% of sucrose and 0.06 % Silwet L-77) was directly applied to flower buds by pipetting. In case of co-transformation, FastRed and FastGreen vectors were transformed separately into Agrobacterium and grown overnight in 5ml cultures at 28°C. The cultures were centrifuged for 10 min at 4000 rpm, the pellets resuspended in sucrose and Silwet L-77 solution. The resuspended FastRed and FastGreen pellets were mixed in equal amount to make a cocktail for transforming both constructs at same time.

Generation of CRISPR/Cas9 vectors

The primers used to generate all vectors are indicated in Supplementary Table 1. pChimera (Addgene ID 61432) (Fauser et al., 2014) was used as a template to generate pRU41, pRU43, pRU45 and pRU47 vectors. The pRU42, pRU44, pRU46 and pRU48 were generated by replacing the pU6 promoter with pU3. The corresponding BsaI sites were introduced to generate compatible overhangs in all the entry clones as shown in Figure 1. The intermediate vectors pSF463, pSF278, pSF464, pSF279, pSF280, pSF325 were generated by introducing the corresponding BsaI sites into pDONR221 containing ccdB cassette and flanking attL1 and attL2 recombination sites ready for single fragment Gateway cloning. The final T-DNA vectors were generated using pDe-Cas9 as template (Addgene ID 61433) (Fauser et al., 2014). The FastRed, FastGreen and FastCyan selection cassettes were amplified from pFRm43GW (Addgene ID 133748), pFG7m34GW (Addgene ID 133747) (Wang et al., 2020) and UBQ::NLS-mTurquoise2 (Emonet et al., 2021) vectors and introduced into pDe-Cas9 vector in place of PPT selection using HindIII restriction sites. Different Cas9 and Cpf1 variants, as well as Cas9i were amplified from vectors pDe-SaCas9 (Steinert et al., 2015), pYPQ220 (Addgene ID 86208) (Tang et al., 2017) and pAGM47523 (Addgene ID 153221) (Grützner et al., 2021) and introduced by replacing Cas9 in pDe-Cas9 vector. pEC1.2 was amplified from pHEE401E (Addgene ID 71287) (Wang et al., 2015) vector and introduced into different vectors by replacing the PcUBi4-2 promoter vector using KpnI restriction sites. All vectors generated in this study are shown in Table 1, Supplemental Figure 1 and Supplemental Tables 1 and 2 and are deposited at Addgene plasmid repository. Primers used for modifying the vectors are indicated in Supplemental Table 3. The primers for introducing the required gRNAs into entry vectors are indicated in Supplementary Table 4 and the detailed procedure of generating T-DNA vectors carrying the gRNAs is described in Supplemental Materials and Methods.

Screening of CRISPR mutants

Fluorescent seeds of T1 plants carrying FastGreen, FastRed and FastCyan cassettes, as well as dark (non-fluorescent) seeds of T2 lines were screened using Leica MZ16FA Fluorescence Stereomicroscope. The filters used for different colours are as follows: DSR (LEICA 10447227) for FastRed; GFP3 (LEICA 10447217) for FastGreen; CFP (LEICA 10447409) for FastCyan; GFP2 (LEICA 10447221) for yellow seeds carrying both FastRed and FastGreen constructs. Genomic DNA of transgenic CRISPR T1 and non-transgenic T2 plants was extracted using modified CTAB method. The leaves and flowers were used for DNA extraction. The plant material was crashed using pipette tips directly in 100μl CTAB buffer and incubated for 40 min at 65C. 100μl of chloroform/isoamyl alcohol (16/1 ratio) was added, mixed by inverting and centrifuged for 5min at max speed. The upper phase was collected, mixed with 50μl of isopropanol and incubated overnight. Next day, the samples were centrifuged for 10 min at maximum speed. The liquid was discarded and, after drying, the pellet was resuspended in 50 μl of water. Primers used for genotyping and sequencing are indicated in Supplementary Tables 5 and 6.

Lignin staining and confocal microscopy

ClearSee‐adapted Basic Fuchsin staining for lignin was performed as described earlier (Ursache et al., 2018). Confocal pictures of Basic Fuchsin stained sgn3 mutant roots were obtained using Zeiss LSM 880 confocal microscope. The excitation and emission spectra for Basic Fuchsin are 561 nm and 570–650 nm accordingly.

Supplementary Materials and Methods CRISPR/Cas9 Cloning Protocol

1. Primer design

Pick your 20 nucleotide protospacer sequence and order desalted oligos:

  • For pRU41 (pU6-gRNA1) vector:

    • Forward primer: 5′-ATTG + protospacer
    • Reverse primer: 5′-AAAC + rev-com protospacer
  • For pRU42 (pU3-gRNA2) vector:

    • Forward primer: 5′-GTCA + protospacer
    • Reverse primer: 5′-AAAC + rev-com protospacer
  • For pRU43 (pU6-gRNA3) vector:

    • Forward primer: 5′-ATTG + protospacer
    • Reverse primer: 5′-AAAC + rev-com protospacer
  • For pRU44 (pU3-gRNA4) vector:

    • Forward primer: 5′-GTCA + protospacer
    • Reverse primer: 5′-AAAC + rev-com protospacer
  • For pRU45 (pU6-gRNA5) vector:

    • Forward primer: 5′-ATTG + protospacer
    • Reverse primer: 5′-AAAC + rev-com protospacer
  • For pRU46 (pU3-gRNA6) vector:

    • Forward primer: 5′-GTCA + protospacer
    • Reverse primer: 5′-AAAC + rev-com protospacer
  • For pRU47 (pU6-gRNA7) vector:

    • Forward primer: 5′-ATTG + protospacer
    • Reverse primer: 5′-AAAC + rev-com protospacer
  • For pRU48 (pU3-gRNA8) vector:

    • Forward primer: 5′-GTCA + protospacer
    • Reverse primer: 5′-AAAC + rev-com protospacer

2. Cloning gRNAs into pRU41-48 using Oligo annealing

  • 1 μl of each oligo (100 μM) + 48 μl H20
  • Incubate for 5 min at 95°C (thermocycler, no cooling at the end!)
  • Cooling at room temperature for 20 min
  • Digest entry vector:

    • 5 μl of corresponding pRU41-pRU48 entry vector
    • 1 μl of FastDigest Buffer (ThermoScientific)
    • 1 μl FastDigest BbsI (Bpi) enzyme (Thermo Fisher)
    • adjust water to 10 μl final volume and incubate for >1 h at 37°C (overnight is optimal)
    • Gel extract the digested vector and adjust the concentration to 5 ng/μl
  • Ligation

    • μl of corresponding digested pRU41-48 entry vector
    • 3 μl of annealed oligos
    • 1,5 μl of T4 Ligase (ThermoScientific)
    • 2 μl T4 buffer
    • 1.5 μl H2O
    • Incubate for at least 1h at 22 °C or room temperature
    • Transform everything in DH5α, plate on LB plates supplied with Ampicillin
  • Colony-PCR

    • Test 4 colonies (efficiency >70%) using oRU385 + gRNA reverse oligo
  • Miniprep

    • Sequence using oRU385 primer and adjust plasmid concentrations to 100 ng/μl

3. Golden Gate Assembly

  • Download figure
  • Open in new tab
  • Download figure
  • Open in new tab

Run Golden Gate program in a thermocycler as follows

  • Download figure
  • Open in new tab
  • Transform everything into E.coli DH5α cells and plate transformed cells on LB/Kan plates.
  • Check 2-4 colonies, miniprep, sequence using M13 and M13 reverse primers. To check the gRNA’s in the middle, gRNA primers can be used as colony PCR and sequencing primers.

4. Final Single Fragment Gateway LR Reaction

  • 2 μl of your intermediate vector with gRNAs assembled (adjusted to 50 ng/μl)
  • 3 μl of the final Cas9 vector (adjusted to 50 ng/μl)
  • 4 μl TE buffer, pH 8
  • 1 μl LR clonase II
  • Incubate overnight at room temperature
  • Proteinase K treatment: add 1 μl and incubate for 10 min at 37°C
  • Transform everything in DH5α and plate everything on LB plates with Spectinomycin
  • Miniprep, all colonies should be positive, inoculate 1-2 colonies
  • Sequence using oRU906, oRU908 primers or gRNAs as primers

Primer Sequences

  • oRU906: GAGTCTATGATCAAGTAATTATGC
  • oRU908: GCTTGCATGCCTGCAGGTCGACTCT
  • oRU385: CAACGCGTTGGGAGCTCTCCCATATG

Article TitleCombined fluorescent seed selection and multiplex CRISPR/Cas9 assembly for fast generation of multiple Arabidopsis mutants

Abstract

Multiplex CRISPR-Cas9-based genome editing is an efficient method for targeted disruption of gene function in plants. Use of CRISPR-Cas9 has increased rapidly in recent years and is becoming a routine method for generating single and higher order Arabidopsis mutants. To facilitate rapid and efficient use of CRISPR/Cas9 for Arabidopsis research, we developed a CRISPR/Cas9-based toolbox for generating large deletions at multiple genomic loci, using two-color fluorescent seed selection. In our system, up-to eight gRNAs can be routinely introduced into a binary vector carrying either FastRed, FastGreen or FastCyan fluorescent seed selection cassette. Both, FastRed and FastGreen binary vectors, can be co-transformed as a cocktail via floral dip to introduce sixteen gRNAs at the same time. The seeds can be screened either for red or green fluorescence, or for the presence of both colors at the same time. Our approach provides fast and flexible cloning, avoids very big constructs and enables screening different order mutants in the same generation. Importantly, in the second generation after transformation, Cas9 free plants are identified simply by screening the dark, non-fluorescent seeds. Our collection of binary vectors allows to choose between two widely-used promoters to drive Cas enzymes, either the egg cell-specific (pEC1.2) or ubiquitous promoter (PcUBi4-2). Available enzymes are “classical” Cas9, a recently reported, intron-optimized version or Cpf1 (Cas12a). Finally, we have taken care to introduce convenient restriction sites flanking promoter, Cas9 and fluorescent selection cassette in the final T-DNA vectors, thus allowing straightforward swapping of all three elements for further adaptation and improvement of the system.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.