Materials and Methods

Rational guide RNA engineering for small-molecule control of CRISPR/Cas9 and gene editing

MATERIALS AND METHODSMaterialsThe oligonucleotides at HPLC purity were obtained from TaKaRa company (Dalian, China). Cas9 nuclease, Streptococcus pyogenes (product# M0646), Bst DNA pol, Large Fragment (product# M0275), T4 DNA Ligase (product# M0202S), Ribonucleotide solution mix (NTPs, product# N0450) and deoxy-ribonucleoside triphosphates (dNTPs, product# N0446) were purchased from New England Biolabs (Ipswich, MA, USA). Transcript Aid T7 High Yield Transcription kit (product# K0441) and Lipofectamine 3000 transfection agent (product# L3000015) were purchased from Thermo Fisher Scientific Inc. Pyrobest™ DNA Polymerase (product# R005A) and PrimeSTAR HS DNA Polymerase (product#R010A) was purchased from TaKaRa Shuzo Co. Ltd. (Tokyo, Japan). DNeasy Blood & Tissue kit (product# 69504) was purchased from Qiagen (Germany). The nucleic acid stains Super GelRed (NO.: S-2001) was purchased from US Everbright Inc. (Suzhou, China). The pH was measured with Mettler Toledo, FE20-Five Easy™ pH (Mettler Toledo, Switzerland). The concentration of nucleic acids was quantified by NanoDrop 2000c (Thermo Scientific, USA). The gel electrophoresis was run in a temperature-controlled vertical electrophoretic apparatus (DYCZ-22A, Liuyi Instrument Factory, Beijing, China). Gel Imaging was performed using Pharos FX Molecular imager (Bio-Rad, USA). The Discovery Series Quantity One 1D Analysis Software Version 4.6.9 was used to determine the percentage of indel formation. The UV melting studies were performed on a Jasco-810 spectropolarimeter (Jasco, Easton, MD, USA) equipped with a Peltier temperature controller.SynthesisThe NCD and Z-NCTS were synthesized according to previous reports (39).Construction of designer gRNAs with MBL-binding units In vitro transcription reactions were performed to prepare each sgRNA and tracrRNA. Point mutations were introduced at nts 41, 66 and 76, respectively (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT to GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCGGTTATCAACTTGAAAAAGTGGCACGGAGTCGGTGGTTTT). An overlap extension is performed to assemble smaller DNA fragments into a larger sequence, which was used for making each sgRNA and tracrRNA (15). For sgRNA preparation, the forward primer was designed to contain T7 promoter, variable guide sequence, the first 31 nt of the conserved region of the sgRNA scaffold (sg-SLX4IP-F, sg-HPRT1-F, sg-GFP-F or sg-HBEGF-F). And the reverse primer was designed to contain the reverse complement of the conserved region of the sgRNA scaffold (sgRNA-R, sgRNA-S1a-R, sgRNA-S1b-R, sgRNA-S1c-R, sgRNA-S2a-R, sgRNA-S2b-R, sgRNA-S2c-R or sgRNA-S3-R in Supplementary Table S1). Pyrobest™ DNA Polymerase was used for overlap extension reaction. Assembled template (300 ng) was used as a substrate for in vitro transcription by T7 RNA polymerase, using the Transcript Aid T7 High Yield Transcription kit following the manufacturer's instructions. Resulting transcription reactions were treated with DNase I, and RNA was purified using the NaOAc/phenol/chloroform method.For tracrRNA preparation, the forward primer was designed to contain T7 promoter, the first 46 nt of the tracrRNA scaffold (tracrRNA-F). And a 66 nt primer was designed to contain the reverse complement of the tracrRNA scaffold (tracrRNA-R, tracrRNA-S1a-R, tracrRNA-S1b-R, tracrRNA-S1c-R, tracrRNA-S2a-R, tracrRNA-S2b-R, tracrRNA-S2c-R or tracrRNA-S3-R in Supplementary Table S1). For overlap extension and in vitro transcription reaction, the conditions were the same as the above sgRNA protocol.Ligand control of designer sgRNAs for CRISPR/Cas9 In vitro Cas9 cleavage assay was performed in 1 × NEBuffer™ 3.1, which contained 100 mM NaCl, 50 mM Tris–HCl, 10 mM MgCl2 and 100 μg/ml BSA at pH 7.9 @ 25°C. Target GFP fragments were PCR amplified from pEGFP-C1 vector (Clontech) using t-GFP-F and t-GFP-R as primers. Other target DNA fragments were PCR amplified from genomic DNA (HeLa cells) using the following primers: t-SLX4IP-F and t-SLX4IP-R for t-SLX4IP; t-HPRT1-F and t-HPRT1-R for t-HPRT1; t-HBEGF-F and t-HBEGF-R for t-HBEGF. Briefly, original or designer sgRNAs (50 ng) were incubated with each MBL at various concentrations in the presence of Cas9 (0.2 μM), in 1 × NEBuffer™ 3.1 buffer at room temperature for 30 min. The Cas9-mediated DNA cleavage reactions were started by rapid mixing of equal volumes of the sgRNA/Cas9 preparation with a solution containing target DNA fragments (50 ng) in 1 × NEBuffer™ 3.1 buffer, and subjected to an incubation at 37°C for different incubation times. Reactions were quenched by adding SDS containing loading dye and loaded onto a 1.5% agarose gel containing 1.5 × Super GelRed for visualization (100 V, 1.5 h). The GeneRuler 100-bp DNA Ladder was used as DNA size marker. After electrophoresis, in gel targets were analyzed using a Pharos FX Molecular imager (Bio-Rad, USA).Ligand control of designer tracrRNAs for CRISPR/Cas9 In vitro Cas9 cleavage assay was performed in 1 × NEBuffer™ 3.1. For the 2-part gRNA study, crRNA and each designer tracrRNA were annealed at room temperature for 10 min to form the gRNA complexes. For the MBL incubation step, similar reactions were set up using 15 ng of each crRNA and 25 ng of tracrRNA instead of 50 ng of each sgRNA. For Cas9-mediated DNA cleavage reactions, the conditions were the same as the above sgRNA protocol. The original tracrRNAs were used in control reactions.Ligand control of designer sgRNAs in a stable Cas9-expressing cell lineOne day prior to transfection, 4 × 105 HeLa-OC cells per well were seeded into a 6-well plate containing 0.5 ml medium. HeLa-OC cells were transfected with 2.5 μg each sgRNA using a standard transfection protocol. Each sgRNA was transfected as biological triplicates in three separate wells and processed independently. In brief, each sgRNA was mixed in a 125-μl DMEM. Thereafter, an equal volume of DMEM with Lipofectamine 3000 transfection agent (5.0 μl) was added and incubated for 15 min. The complex was subsequently added dropwise to the cells. After an incubation time of 4 h, the medium was changed to complete medium supplemented with appropriate concentrations of NCD. Cells were further cultured at 37°C in 5% CO2 for an additional 24 h.Cell cultures were washed with PBS prior to DNA extraction. The genomic DNA was extracted using Qiagen DNeasy Blood and Tissue Kit following the manufacturer's protocol. PCR across the target site in different genes was run using the according amplicon primer set. All PCRs were performed using PrimeSTAR HS DNA Polymerase. PCR was performed in solution with a final volume of 20 μl, containing 0.5 μM of each target region amplification primer. The cycling conditions are as following: initial denaturation at 94°C for 15 s; 35 cycles consisting of 10 s of denaturation at 98°C, 1 min of annealing and extension at 68°C. The amplified DNA products were purified via Zymo Research DNA Clean and Concentrator Kit.The cleavage activity of CRISPR/Cas9 at endogenous loci was quantified using T7E1 assay. All subsequent steps were performed independently for the triplicates. 100 ng of PCR product carrying the target loci was heated to 98°C and slowly cooled down to let DNA reanneal. Annealed DNA was digested with T7 endonuclease I (NEB) for 30 min at 37°C. Reaction was quenched by adding SDS containing loading dye and loaded onto a 1.5% agarose gel containing 1.5 × Super GelRed for visualization (100 V, 1.5 h). The percentage of cleavage was quantified using a Pharos FX Molecular imager (Bio-Rad, USA) running Image Lab™ 4.1. The percentage of indel formation = 100 × (1 – (1 – fraction cleaved)0.5).Ligand-control of the hybrid system in human cellsPX165 (pSpCas9) was obtained from Addgene (plasmid# 48137) (5). One day prior to transfection, 4 × 105 HeLa cells per well were seeded into a six-well plate containing 0.5 ml medium. HeLa cells were transfected with 2.5 μg PX165 plasmid using a standard transfection protocol. In brief, PX165 plasmid was mixed in a 125-μl DMEM. Thereafter, an equal volume of DMEM with Lipofectamine 3000 transfection agent (5.0 μl) was added and incubated for 15 min. The complex was subsequently added dropwise to the cells. After 4-h of incubation, cells were treated with Lipofectamine 3000 loaded with endogenous gene targeting sgRNAs (original or designer) for 4 h. The sgRNA dose was 2.5 μg/well each sgRNA. After an incubation time of 4 h, the medium was changed to complete medium supplemented with appropriate concentrations of NCD. Cells were further cultured at 37°C in 5% CO2 for an additional 24 h. The target editing efficiency and inhibition thereof were quantified by T7E1 assay. Data were normalized on samples without NCD treatment.Construction of designer plasmids with MBL-binding unitsPX459 (pSpCas9(BB)-2A-Puro V2.0) was obtained from Addgene (Plasmid #62988) (5). A starting PX459 plasmid was used to construct the designer plasmid with MBL-binding units (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT was changed to GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACGGAGTCGGTGGTTTT). Point mutations were created through overlap extension PCR of the region between unique restriction sites (PciI/SnaBI) of PX459, and two primer pairs forward primer in upstream region (S2c-up-F), reverse primer in upstream region (S2c-up-R); forward primer in downstream region (S2c-down-F), reverse primer in downstream region (S2c-down-R) were used. The two purified fragments were used in the overlap extension PCR to produce the fused fragment containing MBL-binding units. The expected sizes for amplicons were as follows: 376 bp for S2c-up (upstream region); 403 bp for S2c-down (downstream region); 749 bp for the fused fragment. Assembled PCR products were amplified with Pyrobest™ DNA Polymerase using forward and reverse oligonucleotides (S2c-up-F and S2c-down-R) with homology upstream or downstream of the PciI and SnaBI restriction sites, respectively. PX459 plasmid was digested with PciI/SnaBI to remove the original sgRNA cassette. The assembled PCR products and the digested plasmids were assembled with the in-fusion cloning method to produce the target plasmid PX459-S2c. Constructed plasmids were sequenced to confirm the replaced strand region using the primer (5′-CTTTTGCTGGCCTTTTGCTCA-3′).Forward and reverse oligonucleotides containing the guide sequences for SLX4IP and HBEGF with appropriate overhangs were annealed by mixing 100 pmol of each pair and then incubated at 90°C for 5 min and slowly ramped to room temperature. The PX459 or PX459-S2c plasmid was digested using restriction enzyme BbsI and run on a 0.8% agarose gel. The sample was cut out and purified. The digested plasmid was ligated with the annealed oligonucleotide to generate the designer construct. Correct insertion of target sequences into the vectors was confirmed by Sanger sequencing using the following primer: GAGGGCCTATTTCCCATGATT.Ligand control of designer all-in-one plasmid with MBL-binding units in human cellsHeLa cells were seeded in a six-well plate 24 h prior to transfection. Unless stated otherwise, 4 × 105 HeLa cells were transfected with 2.5 μg of each complete plasmid using 5 μl lipofectamine 3000, following manufacturer's instructions. Each complete plasmid was transfected as biological triplicates in three separate transfections. After 4 h of transfection, the medium of the ‘control groups’ and the ‘experimental groups’ was replaced by the same medium, but in the ‘experimental groups’ it contained different concentrations of NCD. Then, the groups of cells were incubated for another 24 h. The cells were then lysed and genomic DNA was extracted and PCR-amplified around the target locus. Finally, the T7E1 assay was performed for measuring endogenous gene editing. Data were normalized on samples without NCD treatment.Statistical analysisStatistical significance was determined with an unpaired, two-tailed Student's t-test with Origin software (OriginLab Corporation, Northampton, MA). P values <0.05 were considered statistically significant.

Article TitleRational guide RNA engineering for small-molecule control of CRISPR/Cas9 and gene editing

Abstract

It is important to control CRISPR/Cas9 when sufficient editing is obtained. In the current study, rational engineering of guide RNAs (gRNAs) is performed to develop small-molecule-responsive CRISPR/Cas9. For our purpose, the sequence of gRNAs are modified to introduce ligand binding sites based on the rational design of ligand–RNA pairs. Using short target sequences, we demonstrate that the engineered RNA provides an excellent scaffold for binding small molecule ligands. Although the ‘stem–loop 1’ variants of gRNA induced variable cleavage activity for different target sequences, all ‘stem–loop 3’ variants are well tolerated for CRISPR/Cas9. We further demonstrate that this specific ligand–RNA interaction can be utilized for functional control of CRISPR/Cas9in vitroand in human cells. Moreover, chemogenetic control of gene editing in human cells transfected with all-in-one plasmids encoding Cas9 and designer gRNAs is demonstrated. The strategy may become a general approach for generating switchable RNA or DNA for controlling other biological processes.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.