Materials and Methods

Detection ofCampylobacter jejunidiversity by clustered regularly interspaced short palindromic repeats (CRISPR) from an animal farm

2. MATERIALS AND METHODS2.1. Bacterial cultures and genomic DNA isolationSeventy‐seven C. jejuni isolates from 2016 and an animal farm were used in this study and are listed in Table S1 (Rothrock et al., 2019). Briefly, the farm was about 3 acres in size. The day‐old broilers were transported to the farm, where other poultry and farm animals were also reared, including layer hens, guinea hens, dairy goats and sheep. A small swine herd was also present on an adjacent, but separate plot of land (Rothrock et al., 2019). Fresh fecal samples were collected from the pen area. At the same time, any fecal samples from other animal species surrounding the broiler area on the farm were also collected. Cecal samples were collected after exsanguination. Rinsates were generated by rinsing the carcasses with 100 ml of 10 mM phosphate‐buffered saline in sterile individual bags. All samples were placed on ice at the farm and transported to the laboratory. In the laboratory, isolation and identification of C. jejuni were performed according to the standard procedures. Bacterial cultures stored in 15% glycerol at –80°C were revived in Müeller–Hinton agar plates at 42°C for 48 h under microaerobic conditions as described previously (Hiett et al., 2008; Yeh et al., 2013).Genomic DNA was isolated using a DNeasy Blood and Tissue kit (Qiagen Inc., Germantown, MD, USA) according to the manufacturer's instructions. The quality and quantity of genomic DNA were determined by agarose gel electrophoresis and a spectrophotometer (DS‐11 FX spectrophotometer; DeNovix Inc., Wilmington, DE, USA), respectively. The DNA in 10 mM Tris–HCl (pH 8.0) was stored at –80°C.2.2. PCR amplification of C. jejuni CRISPR and sequencingThe PCR primers and conditions for amplification of the C. jejuni CRISPRs were described previously (Price et al. 2007). The amplicons were purified with a DNA Clean & Concentrator‐5™ kit (Zymo Research, Irvine, CA, USA). The purity of the PCR products was examined with agarose gel electrophoresis. The purified amplicons were sent for DNA sequencing at the USDA ARS Genomics and Bioinformatics Research Unit (Stoneville, MS, USA), where Big Dye terminator chemistry on an ABI 3100 Genetic Analyzer (Thermo Scientific, Foster City, CA, USA) was used. Sequence chromatograms were edited for quality. The same primer pairs for amplification and sequencing were as follows (Price et al. 2007): CRISPR‐F 5′‐GCAACCTCCTTTTAGTGGAGTAATTAG‐3′ and CRISPR‐R 5′‐AAGCGGTTTTAGGGGATTGTAAC‐3′.2.3. Analysis of CRISPR sequencesCRISPR sequences were submitted to the CRISPR Web Server and were identified using the CRISPRFinder program (Grissa et al., 2007; https://crispr.i2bc.paris‐saclay.fr/). Simpson's index of diversity was calculated based on the Hunter and Gaston equation to determine the discriminatory power of genotyping methods (Carriço et al. 2006). The sequences were deposited in GenBank, and the accession numbers are {"type":"entrez-nucleotide-range","attrs":{"text":"MT199732-MT199808","start_term":"MT199732","end_term":"MT199808","start_term_id":"1835288505","end_term_id":"1835288581"}}MT199732-MT199808 (Table S1).

Article TitleDetection ofCampylobacter jejunidiversity by clustered regularly interspaced short palindromic repeats (CRISPR) from an animal farm

Abstract

The sequences were deposited in GenBank, and the accession numbers are{"type":"entrez-nucleotide-range","attrs":{"text":"MT199732-MT199808","start_term":"MT199732","end_term":"MT199808","start_term_id":"1835288505","end_term_id":"1835288581"}}MT199732-MT199808.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.