Materials and Methods

Gene editing of the extra domain A positive fibronectin in various tumors, amplified the effects of CRISPR/Cas system on the inhibition of tumor progression

MATERIALS AND METHODSCell culturePoorly differentiated human nasopharyngeal carcinoma cell line CNE-2Z was purchased from China Infrastructure of Cell Line Resource (Beijing, China), and it was grown in RPMI 1640 medium (Gibco, Grand Island, NY, USA). The colorectal carcinoma cell line SW480 was preserved in Peking University School of Stomatology, it was grown in Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, Grand Island, NY, USA). All the cells were cultured in medium containing 10% fetal bovine serum (FBS, Gibco) at 37°C and 5% CO2.Transfection with Cas9 plasmids containing single guide (sg) RNAsTwo single guide (sg) RNAs, complementing the sequences flanking EDA exon, were designed and cloned into CRIPSR/Cas9 plasmid PX330, as described previously 15, 17, 34.As the CNE-2Z cells reached about 60-70% confluence, and the SW480 reach about 70-80% confluence, the medium were replaced with serum free one for 6 h. Then the two plasmids were co-transfected into the cells respectively, with the Lipofectamine 2000 (Life Technologies). In 24 hours later, puromycin was added to CNE-2Z cells; while in the SW480 cells, puromycin was added at 36 hours after transfection. Both cell lines were incubated with puromycin (1.6 μg/ml) for additional 48 h.The genomic DNA was extracted, and then the efficiency of EDA knockout was accessed with PCR, DNA sequencing was used to confirm EDA knockout 15, 35. Untreated CNE-2Z or SW480 cells were used as control respectively. The sequences of primer and sgRNAs are presented in Table ​Table55.Table 5Sequences of CRISPR sgRNA and confirming primers used in this studyNamesgRNA sequence (5′-3′)PAM sequences(5′-3′)DSB site in fibronectin (FN)genome (ref|{"type":"entrez-nucleotide","attrs":{"text":"NC_018913.2","term_id":"528476665","term_text":"NC_018913.2"}}NC_018913.2|)sgRNA up-stream-FGTTACAGACATTGATCGCCCTAACAG216251681sgRNA up-stream-RAACTTAGGGCGATCAATGTCTGTsgRNA down-stream-FGTTCTGATTGGAACCCAGTCCACAGG216251434sgRNA down-stream-RAACGTGGA CTGGGTTCCAATCAGprimersproductcontaining EDAproduct without EDAPrimer-downatagtgggttaattggact675bp≈400bpPrimer-upagggtaatcacagggagOpen in a separate windowColony-forming unit (CFU) and population doubling time (PDT) assaysEDA-knockout and untreated CNE-2Z or SW480 cells were seeded onto 100-mm dishes at the density of 400 cells/dish for the CFU assay. The cells were cultured in RPMI 1640 or DMEM for 7 days and stained with 0.1% crystal violet, respectively. Aggregations of more than 50 cells were defined as colony formation units (CFUs).Additionally, the two cell lines seeded onto 96-well plates at a density of 1000 cells/well respectively, for the determination of PDT. The cell numbers were determined daily in six wells, using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan), according to the manufacturer's instructions.Wound-healing and transwell invasion assaysCells were seeded into 24-well plates, grown to confluence, synchronized in fresh medium containing 0.5% FBS for 6 h, and the cell monolayer was wounded using a 300-400 μm pipette tip. The average linear speed of the movement of wound edges was quantified over 24 h. Cell invasion assay was performed using transwell chambers with a polycarbonate membrane (Millipore, Bedford, MA, USA), coated with 20 μg ECM gel (Sigma-Aldrich, Trading Co Ltd, Shanghai, China). In the upper chambers, CNE-2Z was seeded at 4×104 cells/well, and SW480 was seed at 1×105 cells/well. After 24 h of incubation, the membranes were stained with 0.1% crystal violet and the cells remaining on the upper surface of the membrane were wiped off.Establishment of the xenograft model and in vivo EDA knockout using CRIPSR/Cas9 systemFour-week-old male BALB/c nude mice were purchased from Vital River Experimental Animal Technique Company (Beijing, China) and maintained in a specific pathogen-free condition. All the animals were acclimatized for 1 week before experiments, and then maintained under controlled temperature (22±2°C), with light dark periods of 12 hours and with free access to water and commercial diet 36.The cells were digested using trypsin and washed by phosphate buffered saline (PBS) twice respectively, the CNE-2Z was re-suspended at the concentration of 3×107cells/ml in PBS; the concentration of SW480 was 5×107cells/ml. Following this, 3×106 CNE-2Z cells as well as 5×106 SW480 cells were subcutaneously injected into the flank region of each mouse, respectively. Tumor volume was measured with caliper and calculated using the following formula: V=length×width2×(π/6) 37. This study was approved by the animal care committee guidelines of the Peking University biomedical ethics committee for laboratory animal welfare ethics, Bejing, China (Permit number: LA2012-53).When the subcutaneous tumor volumes reached 70-100mm3, mice were randomly divided into three groups (n=6). CRISPR/Cas9 plasmids with sgRNAs for EDA knockout, were delivered by intra-tumor injections every 2 days (1μg/μL, 40μL/mouse; EDA knockout group), and the mice with tumors injected with PBS (40μL/mouse) or the CRISPR/Cas9 plasmid without sgRNAs (1μg/μL, 40μL/mouse) were included in the control groups: PBS and Cas9 plasmid groups, respectively. Tumor size and mouse weights were measured every other day. The mice were euthanized at the 17th day, and the weights of tumors were recorded.RNA extraction, reverse transcription, and PCR amplificationTotal RNA was isolated from all cells with TRIZOL reagent (Life Technologies), and 2-μg samples were reverse-transcribed into cDNA using the SuperScript First-Strand Synthesis System (Life Technologies), according to manufacturer's instructions. These reactions were performed in a 20-μL reaction mixture with ABI 7500 real-time PCR system (ABI), including an initial incubation at 95°C for 10 min, followed by 40 cycles of annealing/extension at 60°C for 1 min, and denaturation at 95°C for 15 s. The expression of E-cadherin, N-cadherin, Vimentin, Snail1, alpha-smooth muscle actin (α-SMA), Slug and VEGF was determined and normalized with human β-actin. All primers used in these experiments are described in Table ​Table66.Table 6The primers used for real-time PCRNamePrimerSequence(5′-3′)Gene IDE-cadherinForwardAACGAGGCTAACGTCGTAATCA{"type":"entrez-nucleotide","attrs":{"text":"NM_004360.3","term_id":"169790842","term_text":"NM_004360.3"}}NM_004360.3ReverseCCCAGGGGACAAGGGTATGAAN-cadherinForwardGAGATCCTACTGGACGGTTCG{"type":"entrez-nucleotide","attrs":{"text":"NM_001792.3","term_id":"215422305","term_text":"NM_001792.3"}}NM_001792.3ReverseTCTTGGCGAATGATCTTAGGAVimentinForwardAAGGCGAGGAGAGCAGGATT{"type":"entrez-nucleotide","attrs":{"text":"NM_003380.3","term_id":"240849334","term_text":"NM_003380.3"}}NM_003380.3ReverseGGTCATCGTGATGCTGAGAAGSnail1ForwardGCCTTCAACTGCAAATACTGC{"type":"entrez-nucleotide","attrs":{"text":"NM_005985.3","term_id":"301336132","term_text":"NM_005985.3"}}NM_005985.3ReverseCTTCTTGACATCTGAGTGGGTCα-SMAForwardAAAAGACAGCTACGTGGGTGA{"type":"entrez-nucleotide","attrs":{"text":"NM_001141945.1","term_id":"213688374","term_text":"NM_001141945.1"}}NM_001141945.1ReverseGCCATGTTCTATCGGGTACTTCSlugForwardGAGCATTTGCAGACAGGTCA{"type":"entrez-nucleotide","attrs":{"text":"NM_005985.3","term_id":"301336132","term_text":"NM_005985.3"}}NM_005985.3ReverseCCTCATGTTTGTGCAGGAGAVEGFForwardTTATGCGGATCAAACCTCACC{"type":"entrez-nucleotide","attrs":{"text":"NM_001171630.1","term_id":"284172472","term_text":"NM_001171630.1"}}NM_001171630.1ReverseGAAGCTCATCTCTCCTATGTGCβ-actinForwardCATGTACGGTTGCTATCCAGGC{"type":"entrez-nucleotide","attrs":{"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3"}}NM_001101.3ReverseCTCCTTAATGTCACGCACGATOpen in a separate windowWestern blot analysisTotal proteins were extracted from cells grown in complete medium and the supernatants collected from 24-h serum-deprived cells 15. Proteins were separated on a 12% SDS-PAGE, and transferred to nitrocellulose filter membranes, which were probed with the following antibodies overnight at 4°C: anti-E-cadherin (Santa Cruz Biotechnology, Dallas, TX, USA), anti-Snail1 (Cell Signaling Technology, Danvers, MA, USA), as well as anti-Flag, anti-Vimentin, IST-9, anti-FN, anti-Ki-67, and anti-β-actin (Abcam Ltd., Cambridge, MA, USA) antibodies. Immunocomplexes were detected with an enhanced chemiluminescence blotting kit (Applygen Technology Inc., Beijing, China).Immunofluorescence and immunohistochemical (IHC) stainingCells were fixed in 95% ethanol, blocked in 1% BSA in PBS, permeabilized in 0.5% Triton X-100 in PBS, and stained with anti-F-actin monoclonal antibody (1/500; Abcam Ltd., Cambridge, MA, USA) at 4°C overnight. F-actin was detected by using the indirect immunofluorescence, and fluorescence images were obtained using the DAPI excitation settings on the laser confocal microscope (Lsm 5 Exciter; Zeiss, Jena, Germany).Xenograft tumor tissues were sectioned into 4-μm-thick slices and stained with IST-9, anti-EDA+FN, anti-Ki-67, anti-CD34, and anti-E-cadherin (Abcam Ltd., Cambridge, MA, USA) antibodies at 4°C overnight. They were subsequently incubated with the biotinylated secondary antibody (1:200) for 1 h. The immunocomplexes were visualized with diaminobenzidine (Zhongshan Golden Bridge Biological Technology CO., LTD, Beijing, China). Following the IHC staining for EDA+FN, Ki-67, and E-cadherin, the obtained results were semi-quantitatively analyzed by histological score (H-score) based on the positively stained cell number and staining intensity. The H-score was calculated using the following formula: HS=Σ Pi (1+i)/100, where Pi represents the percentage of stained cells at each intensity score (0-3) 15, 38. The area of microvessels (μm2), identified by CD34 staining of vascular endothelial cells was assessed as previously described 29.Statistical analysisData obtained in vitro was compared between the EDA knockout and untreated cells. All experiments were performed in triplicates. Quantitative data were expressed as mean ± standard deviation (SD) and analyzed using the Student's t-test, for the differences between paired groups.In vivo obtained results were compared between PBS, Cas9 plasmid, and EDA knockout groups. Each group contained six biological samples. H-scores obtained by IHC analyses, the area of microvessels, tumor volumes and the weights of tumor or animal were expressed as mean ± SD, and they were analyzed using one-way analysis of variance (ANOVA) for the difference between these groups. Statistical significance was set at P<0.05.

Article TitleGene editing of the extra domain A positive fibronectin in various tumors, amplified the effects of CRISPR/Cas system on the inhibition of tumor progression

Abstract

The low efficiency of clustered, regularly interspaced, palindromic repeats-associated Cas (CRISPR/Cas) system editing genesin vivolimits the application. A components of the extracellular matrix (ECM), the extra domain A positive fibronectin (EDA+FN), may be a target for CRISPR/Cas system for the pro-oncogenic effects. The exclusion of EDA exon would alter the microenvironment and inhibit tumor progression, even the frequency of gene editing is still limited.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.