Materials and Methods

Primed CRISPR-Cas Adaptation and Impaired Phage Adsorption inStreptococcus mutans

MATERIALS AND METHODSBacterial strain, phage, and culture conditions. The wild-type strain S. mutans P42S (38, 46) and the virulent phage M102AD (Siphoviridae) were obtained from the Félix d’Hérelle Reference Center for Bacterial Viruses (www.phage.ulaval.ca). The conditions to grow the bacterial strains and amplify the phage were described previously (14).BIM assays. A culture of S. mutans P42S grown overnight was transferred (1%) to fresh brain heart infusion (BHI) medium and grown until an optical density at 600 nm (OD600) of 0.4 was reached. The bacterial culture was then mixed in BHI top agar with the appropriate PFU per milliliter of phage M102AD to obtain the desired MOI. The mixture was poured on solid medium, and plates were incubated at 37°C for 72 h. Surviving cells were analyzed for spacer acquisition through the amplification of the CRISPR locus using the primers CR-F (5′-AATGTCGTGACGAAAATTGG-3′) and CR-R (5′-GAAGTCATCGGAACGGTCAT-3′). PCR products were sequenced using an ABI 3730xl analyzer at the Centre de Génomique du CHU de Québec-Université Laval.Plasmid interference assays. Plasmid interference assays were performed as described previously (14). Plasmid constructs were prepared using the vector pNZ123 (47), which contains a chloramphenicol resistance gene and is transformable in S. mutans. The 24 bp between the XhoI and EcoRI restriction sites were removed, and the linearized plasmid was purified from an agarose gel using the QIAquick gel purification kit as described by the manufacturer. DNA inserts were ligated between these restriction sites. These DNA inserts consisted of sequences from the phage M102AD genome that were targeted by various spacers.The first insert was the target of spacer 157. This 30-bp spacer matches a region of the phage M102AD genome (positions 19006 to 18977) in 29 out of 30 bp and had a mismatch at position 12. The protospacer in the M102AD genome is flanked by the PAM 5′-TAAAG-3′. This 30-bp target and the flanking PAM were cloned between the XhoI and EcoRI restriction sites of pNZ123 to generate pNZsp157. A second insert was the target of spacer 314, a 30-bp-long spacer with mismatches at positions 1, 9, and 13 compared to the genome of M102AD. The spacer targets a 30-bp stretch on the M102AD genome (positions 21055 to 21028) that is flanked by 5′-TAAAA-3′. This targeted sequence and PAM were cloned into pNZ123 to generate pNZsp314. Clones were confirmed by sequencing, and the sequences of the inserts of the constructs are shown in Table 4.TABLE 4Sequences of the protospacers and PAMs cloned into pNZ123aConstructInsert sequence (5′–3′)Targeting spacer sequence (5′–3′)pNZsp157TCCACTAATTTCGTCATCACTAAAATCAACTAAAGTCCACTAATTTTGTCATCACTAAAATCAACpNZsp314GATACAAACAATAAACTAGCTGACAAACCTAAAATGATACAATCAACAAACTAGCTGACAAACCOpen in a separate windowaThe PAM sequences are in italics. Mismatches between the protospacer and the spacer sequences are underlined.Constructs were transformed into S. mutans P42S using natural competence (48). A culture of S. mutans P42S grown overnight in sterile-filtered tryptic soy broth supplemented with 0.5% yeast extract and 0.5% K2HPO4 (TSYE) was transferred to fresh medium and grown at 37°C until the OD600 reached 0.1. Next, aliquots of 500 μl were collected, and 10 μg of plasmid DNA was added to the aliquots. The cultures were incubated at 37°C for 4 h and spun down, and the cell pellets were resuspended in 100 μl of TSYE medium. Samples were plated onto TSYE agar plates supplemented with 5 μg/ml chloramphenicol. Plates were incubated at 37°C for 120 to 168 h.Phage adsorption assay. A culture of S. mutans P42S grown overnight was transferred (2%) to fresh BHI medium and grown until an OD600 of 0.7 was reached. Phage M102AD (103 PFU) was added to 900 μl of this culture and allowed to adsorb for 15 min at 37°C. Cultures were then centrifuged for 1 min at 13,200 rpm, and the titer of the supernatant was determined to determine the fraction of the phages that did not adsorb to the host cells. A BIM was considered to have a reduced phage adsorption phenotype if <80% of the added phage particles had adsorbed to the BIM.

Article TitlePrimed CRISPR-Cas Adaptation and Impaired Phage Adsorption inStreptococcus mutans

Abstract

The wild-type strainS. mutansP42S (38,46) and the virulent phage M102AD (Siphoviridae) were obtained from the Félix d’Hérelle Reference Center for Bacterial Viruses (www.phage.ulaval.ca). The conditions to grow the bacterial strains and amplify the phage were described previously (14).


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.