Materials and Methods

In VivoTargeting ofClostridioides difficileUsing Phage-Delivered CRISPR-Cas3 Antimicrobials

MATERIALS AND METHODSBacterial strains and culture conditions. All bacterial strains were stored at −80°C in their respective medium supplemented with a final concentration of 15% (vol/vol) glycerol or as spore stocks generated as described previously (33). The C. difficile strains used in this study were provided by Louis-Charles Fortier (34) and Seth Walk (25). Strains were struck from freezer stocks onto brain heart infusion (BHI) agar plates (Teknova) and incubated at 37°C in a Coy anaerobic chamber using 85% nitrogen, 5 to 10% hydrogen, and 5% carbon dioxide. Strains were subcultured by inoculating BHI broth with a single colony and incubating at 37°C. BHI agar was supplemented with cycloserine (8 μg/ml), cefoxitin (25 μg/ml), and thiamphenicol (Tm; 15 μg/ml) to select for recombinant C. difficile. The Escherichia coli strains were streaked onto LB agar plates (Teknova) and incubated at 37°C. The E. coli strains were grown in LB broth, which was supplemented where necessary with carbenicillin (50 μg/ml), chloramphenicol (15 μg/ml), or erythromycin (200 μg/ml).DNA isolation and engineering. All kits and reagents were used according to the manufacturers’ instructions. Plasmid and genomic DNA isolation was performed using a Zymo Research plasmid miniprep kit and a Quick DNA fungal/bacterial miniprep kit, respectively. Phage DNA purification was performed as described previously (29). Restriction enzymes, T4 DNA ligase, and DNA polymerases were from New England Biolabs. Routine PCR was performed using Taq DNA polymerase, and high-fidelity amplifications were performed using Phusion DNA polymerase. All PCR products were visualized by gel electrophoresis using 0.8% agarose with GelRed. Recombinant phages containing an expression cassette encoding a bacterial genome-targeting CRISPR RNA and replacing phage gene gp75 by homologous recombination were created. To reduce the potential of ϕCD24-2 to form lysogens, a region of the genome encoding the cI repressor and integrase gene was deleted. The bacterial strains and plasmids used in this study are listed in Table S2 in the supplemental material.TABLE S2Bacterial strains and plasmids used in this study. Download Table S2, DOCX file, 0.02 MB.Copyright © 2020 Selle et al.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.Phage morphology. Phages were prepared for TEM using a modification of the method described by Fortier and Moineau (35). Prior to observation, 1.5 ml of crude lysate was centrifuged for 1 h at 4°C and 24,000 × g. A fraction of the supernatant (approximately 1.4 ml) was gently removed and discarded, and 1 ml of ammonium acetate (0.1 M, pH 7.5) was added to the remaining lysate, which was then centrifuged as described above. This step was performed twice. Washed phage samples were visualized by negative-stain transmission electron microscopy. A glow-discharged Formvar/carbon-coated 400-mesh copper grid (Ted Pella, Inc., Redding, CA) was floated on a 25-μl droplet of the sample suspension for 5 min and transferred quickly to 2 drops of deionized water, followed by transfer to a droplet of 2% aqueous uranyl acetate stain for 30 s. The grid was blotted with filter paper and air dried. Samples were observed using a JEOL JEM-1230 transmission electron microscope operating at 80 kV (JEOL USA, Peabody, MA), and images were taken using a Gatan Orius SC1000 charge-coupled-device camera with Gatan Microscopy (suite 3.0) software (Gatan, Inc., Pleasanton, CA).Phage-handling procedures. ϕCD24-2 in the prophage state was induced from C. difficile CD24 by UV irradiation (302 nm) as described previously (29). Both the wild-type ϕCD24-2 phage (wtPhage) and the CRISPR-enhanced phage (crPhage) were propagated by amplification on C. difficile CD19. An overnight culture of C. difficile CD19 was subcultured 1:100 into BHI broth and incubated at 37°C to an optical density at 600 nm (OD600) of 0.10. MgCl2 and CaCl2 were added to final concentrations of 10 mM and 1 mM, respectively. Bacteriophage was added at a multiplicity of infection (MOI) of 0.02, and the cultures were incubated at 37°C for 7 to 8 h, until some clearance of the culture was observed. Amplification cultures were removed from the anaerobic chamber and centrifuged at 4,000 × g for 20 min. The supernatants were filtered through 0.45-μm-pore-size filters. Phages were precipitated with polyethylene glycol (PEG) by adding 0.2 volume of 20% PEG 8000, 2.5 M NaCl solution (catalog no. P4137; Teknova) and incubating overnight at 4°C. On the following day, the phage suspensions were centrifuged for 10 min at 13,000 × g at 4°C. The supernatants were decanted, and the pellets were resuspended in 5 ml BHI. The phage suspensions were centrifuged for 10 min at 13,000 × g at 22°C to remove the residual PEG. The supernatants were transferred to fresh tubes, and 10 mM MgCl2 and 1 mM CaCl2 were added. The lysates were stored at 4°C until use. The phage titer was determined by the soft agar overlay method. Briefly, 800 μl of 2 M MgCl2, 20 μl of 2 M CaCl2, 500 μl of C. difficile CD19 at an OD600 of 0.3 to 0.6, and 100 μl of phage at a range of dilutions were added to 3 ml of 0.375% BHI agar (Teknova). The mixture was poured onto a 1.5% BHI agar plate, allowed to solidify, and incubated at 37°C anaerobically overnight. On the following day, the plaques were counted and the number of phages per milliliter was calculated.CRISPR targeting sequence. The following sequence consists of the leader sequence (underlined), the repeat sequences (bolded), and the spacer sequence targeting RNase Y (italicized): GTGCTTTTAAATTTACAAAGTATTCCATTTTAATTTTATAGTTTAGATTTTATGATATAATAAAAATATAGAAGTTTTGCAGTGTGCGATATTTGTTACAAAGTAGGGCTTAATACTTGAAATCTAAGATGTTGAGGGTGCGTGATAAGTGTTATCAATTGCACTATTGCCCGCTCACTGCAATTTTAAGAGTATTGTATATATGTAGGTATTGGAAATGCTAAGTTTATTTTGGGGTTTTAGATTAACTATATGGAATGTAAATGGTCTAGCAGCTGATATTGCATCTGCTGCTGTAACTAGTTTTAGATTAACTATATGGAATGTAAAT.In vitro phage efficacy. Phages were diluted to a titer of 2.0 × 108 PFU/ml in BHI plus 10 mM MgCl2 and 1 mM CaCl2. Overnight cultures of C. difficile were subcultured 1:100 into BHI and incubated at 37°C to an OD600 of 0.20. Then, 10 mM MgCl2 and 1 mM CaCl2 were added to the bacterial culture and the culture was mixed 1:1 with phage or BHI plus 10 mM MgCl2 and 1 mM CaCl2. At 0, 2, 4, 6, and 22 h, 10-fold serial dilutions down to 1:106 were made in BHI. A 5-μl volume of each dilution was spotted onto BHI agar and allowed to dry into the surface of the plate. The plates were incubated overnight at 37°C. On the following day, the number of colonies in the densest countable spot was determined and used to calculate the number of cells per milliliter. This experiment was repeated 4 times with wtPhage and crPhage; 1 time with wtPhage and wtPhage Δlys; and 1 time with wtPhage, crPhage, wtPhage Δlys, and crPhage Δlys.Animals and housing. Male and female C57BL/6 mice (age, 5 weeks old) were purchased from The Jackson Laboratory (Bar Harbor, ME) for use in infection experiments. The food, bedding, and water were autoclaved, and all cage changes were performed in a laminar flow hood. The mice were subjected to a 12-h light and 12-h dark cycle.Animal experiments were conducted in the Laboratory Animal Facilities located on the North Carolina State University (NCSU) College of Veterinary Medicine (CVM) campus. The animal facilities are equipped with a full-time animal care staff coordinated by the Laboratory Animal Resources (LAR) division at NCSU. The NCSU CVM is accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC). The Institutional Animal Care and Use Committee (IACUC) at the NCSU CVM approved this study. Trained animal handlers in the facility fed and assessed the status of animals several times per day. Those assessed as moribund were humanely euthanized by CO2 asphyxiation.C. difficile spore preparation. Spores of C. difficile strain CD19 were prepared as described by Thanissery et al. (33) and Perez et al. (36). Briefly, 2 ml of an overnight culture of CD19 in Columbia broth was added to 40 ml of Clospore medium and incubated at 37°C for 7 days, after which time the spores were centrifuged and washed 5 times in cold sterile water. Alternatively, 500 μl of an early-log-phase-growth culture of C. difficile was spread onto a 70% SMC–30% BHI agar plate and incubated at 37°C for 3 to 4 days, as described by Edwards and McBride (37). The growth was then scraped off the agar plate and resuspended in 10 ml of sterile phosphate-buffered saline (PBS). Ten milliliters of 96% ethanol was added, and the mixture was vortexed and allowed to sit on the benchtop for 1 h. The spore mix was then centrifuged at 3,000 rpm for 10 min. The pellet was suspended in 10 ml sterile PBS and centrifuged again. The pellet was then suspended in 1 ml sterile PBS and heated to 65°C for 20 min. Spores prepared by either method were enumerated at the time of their preparation and prior to preparation of the inoculum via serial dilution in the anaerobic chamber and plating onto brain heart infusion supplemented with 0.1% taurocholate. Spore inocula were also enumerated immediately prior to in vivo challenge. The latter method was found to reliably produce significantly more spores than the previous method, so it was utilized after the first biological replicate of the mouse challenge experiments.Antibiotic administration and infection with C. difficile. The mice (n = 80 over three experiments, male and female) were administered 0.5 mg/ml of cefoperazone (dissolved in Gibco distilled water catalog no. 15230147) in their drinking water for 5 days to render them susceptible to C. difficile colonization (23). All mice were then given distilled water to drink for 2 days, after which they were orally gavaged with 105 spores of C. difficile strain CD19 in 25 μl (34). Animals were monitored for clinical signs of disease (weight loss, inappetence, wet stool, hunched posture, ruffled fur), and animals were humanely sacrificed via CO2 asphyxiation if they met the clinical endpoint of a loss of 20% of their initial body weight. Fecal pellets were collected daily, weighed, passed into the anaerobic chamber, and diluted 1:10 (wt/vol) in sterile anaerobic PBS (catalog no. 10010023; Gibco). The diluted pellets were serially diluted and plated onto the C. difficile selective medium cefoxitin d-cycloserine fructose agar (CCFA) to enumerate the vegetative cells. Necropsy was performed on days 2 and 4 postchallenge. The cecal content was harvested for the enumeration of C. difficile on CCFA. Cecal and colon tissue was harvested for histopathology analysis. Note that it was found that not all mice had defecated when stool was collected for bacterial enumeration, especially mice exhibiting severe clinical signs of disease.Treatment with phage. At approximately 4 h after challenge with C. difficile spores, the mice were orally gavaged with 100 μl of 6% (wt/vol) NaHCO3 solution to neutralize stomach acid. After approximately 30 min, this was followed by one of five treatments in 100 μl: vehicle, which was BHI, 10 mM MgCl2, and 1 mM CaCl2 (CD19, n = 20); wtPhage (n = 20); recombinant crPhage (n = 20), all over the course of three independent biological replicates; wtPhage lysogeny mutant (wtPhage Δlys, n = 8); or crPhage lysogeny mutant (n = 8, crPhage Δlys) from one biological replicate. One group was given cefoperazone and vehicle but was not challenged with C. difficile spores (n = 4 from one biological replicate). This group served as the control for the effects of the vehicle on gut tissue in the histopathological analysis. The treatment gavages were repeated twice daily, approximately 8 to 9 h apart, for the duration of the experiment (Fig. 3a).Screening for lysogens. Resuspended fecal pellets were plated on BHI agar supplemented with cycloserine and cefoxitin. Individual colonies were restreaked onto BHI agar twice to isolate bacteria away from phage particles. Colonies were PCR screened using primers to detect the presence of a phage lysogen. For detecting wild-type lysogens, forward primer TGGTAATAGATAGCCTACATTAGTA and reverse primer GTTTACAATTAAATAGCCACT were used. For detecting crPhage lysogens, forward primer TTACTCTACTTTAAGATTCAATTCA and reverse primer CCCAAAATAAACTTAGCATTTC were used. Colonies positive for prophage presence were further screened using primers specific to the wild-type or CRISPR-engineered phage. For titration of phage in fecal samples, resuspended fecal pellets were centrifuged for 10 min at 4,000 × g. Supernatants were filtered through 0.45-μm-pore-size spin filters and used in soft agar overlays as described above.Histopathological examination of the mouse cecum and colon. At the time of necropsy, the cecum and colon were prepared for histology by placing the intact tissue into histology cassettes, which were stored in 10% buffered formalin for 48 h and then transferred to 70% ethyl alcohol for long-term storage. The tissue cassettes were further processed and paraffin embedded and then sectioned. Hematoxylin- and eosin-stained slides were prepared for histopathological examination (University of North Carolina Animal Histopathology & Lab Medicine core). Histological sections were coded, randomized, and scored in a blind manner by a board-certified veterinary pathologist (S.A.M.). Edema, inflammation (cellular infiltration), and epithelial damage for the cecum and colon were each scored on a scale of from 0 to 4, based on a previously published numerical scoring scheme (38). Edema scores were as follows: 0, no edema; 1, mild edema with minimal multifocal submucosal expansion (2 times) or a single focus of moderate submucosal expansion(2 or 3 times); 2, moderate edema with moderate multifocal submucosal expansion (2 or 3 times); 3, severe edema with severe multifocal submucosal expansion (3 times); and 4, the same as a score of 3 but with diffuse submucosal expansion. Cellular infiltration scores were as follows: 0, no inflammation; 1, minimal multifocal neutrophilic inflammation of scattered cells that do not form clusters; 2, moderate multifocal neutrophilic inflammation (greater submucosal involvement); 3, severe multifocal to coalescing neutrophilic inflammation (greater submucosal involvement with or without mural involvement); and 4, the same as a score of 3 but with abscesses or extensive mural involvement. Epithelial damage was scored as follows: 0, no epithelial changes; 1, minimal multifocal superficial epithelial damage (vacuolation, apoptotic figures, villus tip attenuation/necrosis); 2, moderate multifocal superficial epithelial damage (vacuolation, apoptotic figures, villus tip attenuation/necrosis); 3, severe multifocal epithelial damage (same as above) with or without a pseudomembrane (intraluminal neutrophils, sloughed epithelium in a fibrinous matrix); and 4, the same as a score of 3 but with significant pseudomembrane or epithelial ulceration (focal complete loss of epithelium). Photomicrographs were captured on an Olympus BX43 light microscope with a DP27 camera using cellSens Dimension software.Statistical analyses. Statistical tests were performed using Prism (version 7.0b) software for Mac OS X (GraphPad Software, La Jolla, CA, USA). Statistical significance was set at a P value of <0.05 for all analyses. For the in vivo experiments, a Kruskal-Wallis one-way analysis of variance (ANOVA) followed by Dunn’s multiple-comparisons post hoc test was used to calculate significance between treatment groups. A Geisser-Greenhouse two-way ANOVA with Sidak’s multiple-comparisons post hoc test was used to calculate significance between in vitro toxin expression data. A Student's t test corrected for multiple comparisons using the Holm-Sidak method was used to calculate significant differences in conjugation efficiency between groups, and a Mann-Whitney two-tailed t test was used to evaluate histological scores in CD19 infection.Biological materials availability. Base shuttle vectors are available commercially through Chain Biotech. E. coli and C. difficile strains and wild-type ϕCD24-2 phage are available through C.M.T. and L.-C.F. The CRISPR plasmid and engineered phages are proprietary and to be released at the sole discretion of Locus Biosciences.Data availability. The data presented in this study are available upon request.

Article TitleIn VivoTargeting ofClostridioides difficileUsing Phage-Delivered CRISPR-Cas3 Antimicrobials

Abstract

The data presented in this study are available upon request.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.