Materials and Methods

Anti-CRISPR AcrIF9 functions by inducing the CRISPR–Cas complex to bind DNA non-specifically

MATERIALS AND METHODS In vivo assay for Acr activity In vivo assays to detect Acr activity were carried out as originally described (9). pHERD30T (22) derived plasmids were used to express AcrIF9 homologues in P. aeruginosa strain UCBPP-PA14 (PA14), which possesses an active type I-F CRISPR–Cas system. Lysates of a CRISPR–Cas sensitive phage (DMS3m) or a CRISPR–Cas insensitive phage (DMS3) were spotted in ten-fold dilutions onto lawns of PA14 transformed with plasmids expressing Acrs of interest. A strain carrying pHERD30T was used as a negative control. Plates were incubated at 30°C overnight. Homologues to be tested were identified by PSI-BLAST (2 iterations) (23). The protein sequence alignment was constructed and analyzed using Jalview (24).Expression and purification of Csy complex and AcrsThe P. aeruginosa Csy complex including crRNA was expressed from plasmids in Escherichia coli strain BL21(DE3) as previously described (5). Cas7f is tagged with 6xHis. To produce Csy:F9, the constructs expressing Csy complex and crRNA as stated above were co-expressed with pCDF-1b expressing untagged AcrIF9.Cultures of E. coli BL21 (DE3) expressing the protein of interest were grown to an optical density (OD600) of 0.6 and then induced with 1 mM isopropyl-b-D-thiogalactoside (IPTG) for 16 h at 16 °C. Cells were collected by centrifugation at 7000 g for 15 min and resuspended in binding buffer (20 mM Tris pH 7.5, 200 mM NaCl, 5 mM imidazole, 1 mM tris (2-carboxyethyl)phosphine (TCEP)). The cells were lysed by sonication and the resulting lysates were centrifuged at 17 000 g for 25 min to remove cell debris. The supernatant was mixed with Ni-NTA beads and incubated for 1 hr at 4 °C. The lysates and the beads were then passed through a column, washed 5 times with wash buffer (20 mM Tris, pH 7.5, 200 mM NaCl, 30 mM imidazole, 5 mM β-mercaptoethanol) and then eluted in buffer containing 300 mM imidazole. Purified protein was dialysed into 20 mM Tris pH 7.5, 200 mM NaCl, 1 mM TCEP) overnight. Affinity-purified proteins were fractionated by size exclusion chromatography (SEC) using a GE Life Sciences Superdex 200 10/30 column. Fractions were collected in 1 ml volumes and monitored by optical density at 280 nm. Protein purity was assessed by visualization on Coomassie blue R250 stained SDS-PAGE gels.Assessing Acr binding to the Csy complexPurified 6xHis-tagged Csy complex (1000 nM) was bound to Ni-NTA beads and incubated with excess Acr (5000 nM) for 30 min at 4°C in binding buffer (20 mM Tris pH 7.5, 200 mM NaCl, 5 mM imidazole, 1 mM TCEP). Competitor Acr was added in equimolar concentration and incubated for 30 min at 4°C. Bound Csy complex and Acr were collected through centrifugation at 6000 × g for 2 min to remove unbound Acr. The reaction was then washed three times with wash buffer (20 mM Tris, pH 7.5, 200 mM NaCl, 30 mM imidazole, 5 mM β-mercaptoethanol) with a centrifugation step after each wash. The sample was then eluted in elution buffer (20 mM Tris, pH 7.5, 200 mM NaCl, 300 mM imidazole, 5 mM β-mercaptoethanol). The samples were visualized on Coomassie blue R250 stained SDS–PAGE gels. Each experiment was conducted at least three times and the same result was obtained each time. Single representation is shown in Supplementary Figure S2.Site-directed mutagenesisComplementary oligonucleotides comprising the codon to be mutated plus 20 nucleotides in both directions were synthesized by Eurofins Genomics. The entire plasmid template was then PCR amplified with the primers containing the mutations using Phusion DNA polymerase. Subsequently, the template was digested with DpnI and the PCR product was transformed into E. coli DH5α. Mutations were confirmed by DNA sequencing.DNA binding assaysDNA molecules (sequences shown below) were synthesized (Eurofins Genomics) that contain 32 nucleotides that are either complementary (specific) to the crRNA in the Csy complex or scrambled (non-specific). The DNA was fluorescently labeled at the 5′ end with either 6-FAM or Cy5. To generate dsDNA, the labeled strand was mixed with an unlabeled complementary strand, heated to 100°C, and allowed to return slowly to room temperature. DNA binding reactions were conducted in a binding buffer (10 mM HEPES, pH 7.5, 1 mM MgCl2, 20 mM KCl, 1 mM TCEP, and 6% glycerol) at 37°C for 15 min. A DNA concentration of 100 nM was used in EMSA reactions with Csy or Csy:Acr complexes at 2000 nM. In competitive DNA binding experiments, the Csy complex, or Csy:F9 (1000 nM), were first incubated with 300 nM of DNA at 37°C for 15 min. Then the competitor DNA was added at increasing concentrations with the following ratios (1:1, 1:2, 1:4) and incubated at 37°C for another 15 min. For EMSA experiments with competing Acrs, the Csy complex was first incubated with ten-fold excess of one Acr for 1 hour at 4°C, and then equimolar amount of the competitor Acr was added and incubated under the same conditions. 100 nm DNA was then incubated with the resulting Acr-bound Csy complex at 37°C for 15 min. All EMSA reactions were resolved on native 4% or 6% polyacrylamide TBE gels. Gels were visualized with a Typhoon imager at 473 nm (6-FAM) and 635 nm (Cy5). Every EMSA experiment was carried out at least three times with reproducible results. Single representative gels are shown in figures.For fluorescence polarization (FP) assays, Cy5 labeled DNA probes (4 nM) were incubated with purified Csy or Csy:F9 complexes at increasing concentrations (6.25,12.5, 25, 50,100, 200, 400, 800 nM) in a total volume of 50 ul in Greiner Bio-one 96 well black flat-bottom microplates. The samples were mixed with the assay buffer (20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl2, 0.01% Triton X-100, 2 mM DTT, 0.1 mg/ml bovine gamma globulin) and incubated at 37°C for 30 min. The plate was then analyzed with a Tecan Microplate Reader Spark at 635 nM. The polarization signal was corrected to the reference (Cy5-DNA only) and the blank (assay buffer only). For competitive assays, the Csy or Csy:F9 complex (100 nM) was first incubated with Cy5-labeled DNA at 4 nM for 30 min at 37°C and then competed with increasing concentrations of unlabeled DNA (0, 0.5, 1, 2, 4, 8, 16, 32 nM) for 30 min at 37°C. All FP assays were performed at least three times. Average values are plotted with error bars representing standard deviation.The sequences of the DNA used for DNA binding assays are shown below. Protospacer sequences complementary to the crRNA are in bold and underlined. PAMs are in red. In the 2× and 1× sequences we used a 24 nt protospacer instead of 32 nt in order to keep all dsDNA target sequences used at approximately the same length. We found that the Csy complex binds with similar affinity to a 24 nt protospacer. 50 bp DNASP target strand:

5′:GAATGACCTACAGGTAGACGCGGACATCAAGCCCGCCGTGAAGGCATGTCAA 50 bp DNANS: 5′:GCGCACCTATTAACCGTTCGCAGAAACCAGTAGTAGTCCAAGCGACATGCAG DNA2x target strand: 5′:CGCGGACATCAAGCCCGCCGTGAAGGCATGTCCGCGGACATCAAGCCCGCCGTGAAGGCATGT DNA1x target strand: 5′:GTAGTAGTCCAACGGCATGTAATGACCTACGCGGACATCAAGCCCGCCGTGAAGGCATGT 25 bp DNASP: 5′:CAAGCCCGCCGTGAAGGCATGTCAA 12 bp DNASP: 5′:GCCGTGAAGGCA Open in a separate window In vivo activity measurement for CsySba. The efficiency of transformation assay (EOT) was performed as described previously (25). CsySba was expressed in E. coli BL21-AI in the presence and absence of AcrIF9Vpa. A spacer targeting the ampicillin resistance cassette of pETDuet-1 was used to determine the EOT. EOT equals to the colony ratio between the colony count of the strain of interest and its corresponding Cas3 HD mutant strain, presented as percentages. Error bars represent the standard error of the mean, three replicates were quantified.Bio-layer interferometry (BLI)The conditions used in the BLI experiments were as described previously (26). AcrIF9Vpa and Csy complex were mixed at a molar ratio of 1:1 and incubated for 10 min at room temperature in BLI buffer (0.1 μM BSA and 0.01% Triton X-100). The Csy complex, Csy:F9, or AcrIF9Vpa alone, was tested against 100 nM of either dsDNASP or dsDNANS. Assays were performed in duplicate on the BLItz platform (FortéBio) using High Precision Streptavidin (SAX) Biosensors (FortéBio).Phage plaquing assay P. aeruginosa PA14 was transformed with a vector control or a construct expressing candidate Acr genes on pHERD30T. 150 μl of overnight culture and 10 μl of a lysate of phage DMS3m diluted 106-fold were mixed with soft LB agar and poured onto LB agar plates (MgSO4, 50 μg ml−1 gentamicin and 10 mM arabinose). The plates were grown overnight at 30°C. Individual plaques were counted.Assay of phzM repression and growth curvesA crRNA was designed to target the Csy complex to the promoter region of the phzM gene to block the transcription of the gene and, thus, block pyocyanin production as described previously (16). DNA encoding the crRNA and the Acr of interest was cloned into P. aeruginosa expression vector pHERD30T and was used to transform WT PA14, or PA14 Δcas3, a strain lacking the Cas3 nuclease. The transformants were grown in LB overnight and subcultured into 5 ml King's A medium at a dilution of 1:100. The culture was grown at 37°C for 3 h to reach an OD of 0.6 then induced with 10 mM arabinose. The cells were then grown overnight at 37°C. Pyocyanin was extracted with an equal volume of chloroform then mixed with 2 ml of 0.2 M HCl. The resulting samples were quantitated by measuring absorbance at 520 nm.Overnight cultures of WT PA14, or PA14 Δcas3 strains transformed with the crRNA-expression plasmids described above were diluted 1:100 in LB supplemented with 10 mM arabinose. 150 μl of each sample was then added to a 96-well plate and the optical density at 600 nm was measured every 30 min over the course of 6 hours.

Article TitleAnti-CRISPR AcrIF9 functions by inducing the CRISPR–Cas complex to bind DNA non-specifically

Abstract

Phages and other mobile genetic elements express anti-CRISPR proteins (Acrs) to protect their genomes from destruction by CRISPR–Cas systems. Acrs usually block the ability of CRISPR–Cas systems to bind or cleave their nucleic acid substrates. Here, we investigate an unusual Acr, AcrIF9, that induces a gain-of-function to a type I-F CRISPR–Cas (Csy) complex, causing it to bind strongly to DNA that lacks both a PAM sequence and sequence complementarity. We show that specific and non-specific dsDNA compete for the same site on the Csy:AcrIF9 complex with rapid exchange, but specific ssDNA appears to still bind through complementarity to the CRISPR RNA. Induction of non-specific DNA-binding is a shared property of diverse AcrIF9 homologues. Substitution of a conserved positively charged surface on AcrIF9 abrogated non-specific dsDNA-binding of the Csy:AcrIF9 complex, but specific dsDNA binding was maintained. AcrIF9 mutants with impaired non-specific dsDNA binding activityin vitrodisplayed a reduced ability to inhibit CRISPR–Cas activityin vivo. We conclude that misdirecting the CRISPR–Cas complex to bind non-specific DNA is a key component of the inhibitory mechanism of AcrIF9. This inhibitory mechanism is distinct from a previously characterized anti-CRISPR, AcrIF1, that sterically blocks DNA-binding, even though AcrIF1and AcrIF9 bind to the same site on the Csy complex.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.