Materials and Methods

Comparison of CRISPR and adenovirus-mediated Myd88 knockdown in RAW 264.7 cells and responses to lipopolysaccharide stimulation

MATERIALS AND METHODSCell line and reagentsThe RAW 264.7 macrophage cell line was purchased from American Type Culture Collection (TIB-71; ATCC; Manassas, VA). Dulbecco’s Modified Eagle Medium (DMEM; 4.5 g/L glucose, 110 mg/L sodium pyruvate, and L-Glutamine; 11995065), phosphate buffered saline (10010023), fetal bovine serum (FBS; A3160402), penicillin-streptomycin (15070063), Halt™ protease & phosphatase inhibitor cocktail (100X; 78446), Novex™ Tris-Glycine Transfer buffer (25X; LC3675), Novex™ Tris-Glycine SDS Running Buffer (10X; LC2675), Novex™ 4%–20% Tris-Glycine Mini Gels (WedgeWell™ format, 15-well; XP04205BOX), and SuperSignal™ West Pico PLUS Chemiluminescent Substrate (34578) were purchased from ThermoFisher Scientific (Waltham, MA). Albumin solution from bovine serum (BSA; A3059) was purchased from Sigma-Aldrich (St. Louis, MO). Western immunoblotting antibodies for Vinculin (13901S), MyD88 (D80F5), and CD80 (54521) were purchased from Cell Signaling Technology (Danvers, MA). Cell Lysis buffer (10X; 9803), Tris-Buffered Saline with Tween20 (TBST-25X; 9997S), and LPS were also purchased from Cell Signaling Technology.Cell culture and cell stimulationRaw 264.7 cells were thawed, passaged, and grown according to Hobbs et al., 20. Antibiotic free DMEM containing 10% FBS was used as growth media as well as for CRISPR/Cas9 transfection. Macrophages were serum starved in antibiotic free DMEM containing < 0.01% BSA at 37°C and 5% CO2 for 24 h. Adenoviral transductions were performed using antibiotic free DMEM containing < 0.01% BSA. Following starvation, cells were treated with LPS (10 ng/ml), and harvested for whole cell protein lysate and conditioned growth media at 24 h post-LPS treatment. Time points were determined based on prior detailed LPS time course studies 20 (Fig. 2).Open in a separate windowFigure 2.Timeline of experimental procedures. The point at which the cells were treated with LPS was designated as 0 h.CRISPR/Cas9 transfectionOpti-MEM™ reduced serum medium (31985062), Lipofectamine™ CRISPRMAX™ (CMAX00003), TrueGuide™ tracrRNA (5 nmol; A35533), TrueGuide™ crRNA PC RosA26 (A35518), TrueGuide™ crRNA predefined (Assay Number CRISPR532905_CR; target sequence: GCATCCAACAAACTGCGAGT), and TrueCut™ CAS9 Protein V2 (A36499) were purchased from ThermoFisher Scientific (Waltham, MA). Macrophages were seeded at 30 × 104 cells/ml in 4 ml growth media and incubated for 6 h at 37°C and 5% CO2. Annealing of gRNA and TracrRNA, as well as CRISPR/Cas9 transfection of either ROSA control vector or MyD88 knockdown vector was performed following incubation according to ThermoFisher Scientific standard protocol. Reagents volumes were adjusted to optimize transfection to cell line and seeding density. Transfected cells were expanded 72 post-transfection and allowed to grow an additional 96 h. When cells reached 85%–100% confluency, they were passaged and seeded into six-well tissue culture dishes at 12 × 104 cells/ml for experimentation.Adenoviral transductionAdenoviral sh-RNA pre-validated for MyD88 knockout (ad (RGD)-GFP-m-MyD88-shRNA (shADV-265270)) and an adenoviral sh-RNA vector tagged with GFP (ad)-GFP were purchased from Vector Biolabs (Malvern, PA). At the time cells previously transfected with CRISPR/Cas9 were seeded for experimentation, macrophages that were going to be transduced were seeded at 12 × 104 cells/ml in 4 ml of growth media. Cells were incubated for 16 h at 37°C and 5% CO2. Following incubation, media was changed to serum and antibiotic free media, and transduction of either the adenoviral GFP control vector or MyD88 knockdown vector was performed according to Vector Biolabs standard protocols using 1 × 107 PFU/ml of either control or MyD88 knockdown adenovirus vector. Note that cells underwent transduction 184 h after cells were transfected with CRISPR, as indicated in the previous section. Transduction and serum starvation prior to LPS treatment occurred simultaneously.Western blottingCells were disrupted using Cell Lysis Buffer containing Halt™ protease and phosphatase inhibitor. Subsequent protein lysates were quantified using Bradford assay 21. Western Blotting was done as previously described 22. Membranes were probed for vinculin (124 kDa), p-NFκB (65 kDa), CD80 (50–75 kDa), and MyD88 (33 kDa). Band densities were quantified using NIH Image J (Version 1.60; NIH, Bethesda, MD, USA) 23. MyD88 and p-NFκB expression were normalized to control vectors treated with LPS and vinculin (loading control). CD80 expression were normalized to untreated control vectors and vinculin.Conditioned growth media collection and ELISAsMouse TNF-alpha Quantikine® ELISA kits (SMTA00B), Mouse IL-10 Quantikine® ELISA kits (SM1000B), and Mouse Quantikine® IL-6 ELISA kits (M600B) were purchased from Bio-Techne R&D Systems (Minneapolis, MN). Conditioned growth media was collected, stored, thawed, and prepared for ELISAs according to Hobbs et al. 20. Assays were performed according to the manufacturer’s protocols provided for each respective ELISA kit. Samples, standards, and assay diluent were loaded onto ELISA plates by hand and the rest of the assay, including incubations, were performed using the Dynex Technologies DS2® Automated ELISA System (Chantilly, VA). All values are presented as TNFα, IL-10, or IL-6 secretion (pg/ml) normalized to protein concentration (μg/μl).Statistical analysisAll data are expressed as the mean ± standard deviation, representative of 3–5 independently-conducted experiments. The data for all figures were statistically analyzed with GraphPad Prism 8 software using a one-way ANOVA with Dunnett’s multiple comparison post-test. Differences with P < 0.05 were considered significant.

Article TitleComparison of CRISPR and adenovirus-mediated Myd88 knockdown in RAW 264.7 cells and responses to lipopolysaccharide stimulation

Abstract

Genomic manipulation offers the possibility for novel therapies in lieu of medical interventions in use today. The ability to genetically restore missing inflammatory genes will have a monumental impact on our current immunotherapy treatments. This study compared the efficacy of two different genetic manipulation techniques: clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) transfection to adenoviral transduction to determine which method would provide the most transient and stable knockdown of myeloid differentiation primary response 88 (MyD88). MyD88 is a major regulator of nuclear factor kappa light chain enhancer of activated B cells (NFκB) pathway in Raw 264.7 macrophages. Following genetic manipulation, cells were treated for 24 h with Lipopolysaccharide (LPS) to stimulate the inflammatory pathway. Confirmation of knockdown was determined by western immunoblotting and quantification of band density. Both CRISPR/Cas9 and adenoviral transduction produced similar knockdown efficiency (~64% and 60%, respectively) in MyD88 protein 48 h post adenoviral transduction. NFκB phosphorylation was increased in CRISPR/Cas9-mediated MyD88 knockdown and control cells, but not in adenovirus-mediated MyD88 knockdown cells, following LPS administration. CRISPR/Cas9-mediated MyD88 knockdown macrophages treated with LPS for 24 h showed a 65% reduction in tumor necrosis factor alpha (TNFα) secretion, and a 67% reduction in interleukin-10 (IL-10) secretion when compared to LPS-stimulated control cells (P≤ 0.01 for both). LPS did not stimulate TNFα or IL-10 secretion in adenovirus-mediated control or MyD88 knockdown cells. These data demonstrate that Raw 264.7 macrophages maintain responsiveness to inflammatory stimuli following CRISPR/Cas9-mediated reductions in MyD88, but not following adenovirus-mediated MyD88 knockdown.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.