Materials and Methods

A Transposon-Associated CRISPR/Cas9 System Specifically Eliminates both Chromosomal and Plasmid-Bornemcr-1inEscherichia coli

MATERIALS AND METHODSBacterial strains. The strains used in this study are listed in Table 2, and primers can be found in Table S1 in the supplemental material. E. coli strain WM3064 was used as the donor strain in the study. All strains were cultured at 37°C in Luria Bertani (LB) medium, and diaminopimelic acid (DAP) was supplemented at 0.3 mM for the conjugation assays. When necessary for the selection of transformants, the antibiotics were added at the following concentrations: colistin at 2 μg/ml (abbreviated to CS2), chloramphenicol at 25 μg/ml (abbreviated to C25), and sodium tellurite at 25 μg/ml (abbreviated to ST25).TABLE 2Plasmids and strains used in this studyStrain or plasmidDescriptionReference or studyStrain    E. coli C600Conjugation recipient, F− tonA21 thi-1 thr-1 leuB6 lacY1 glnV44 rfbC1 fhuA1 λ− 40     E. coli C600(pUC19-mcr-1)E. coli C600 harboring pUC19-mcr-1This study    E. coli CSZ4Clinical isolate harboring an IncX4 plasmid pCSZ4 bearing mcr-1 1     E. coli MG1655-MCRE. coli MG1655(ΔrecA::Kan), chromosome bearing mcr-1 12     Salmonella enterica 19E0341Clinical isolate harboring an IncI2 plasmid bearing mcr-1 41     Klebsiella pneumoniae YZ01Clinical isolate harboring an IncI2 plasmid bearing mcr-1This studyPlasmid    pISApl1-CRISPR/Cas9Suicide plasmid harboring Tn::ISApl1-CRISPR/Cas9, R6K ori, mobRP4This study    pUC19-mcr-1pUC19 derivative harboring mcr-1This studyOpen in a separate windowPlasmid construction. We constructed a suicide plasmid consisting of the CRISPR/Cas9 cassette flanked by ISApl1, which possessed the RP4oriT fragment from pCVD442 (37) and the R6K replication origin from pSV03 (12). Traditional antibiotic selection markers were replaced by the Acinetobacter baylyi-derived tellurite resistance marker gene tpm, encoding a thiopurine S-methyltransferase, to allow selection for chromosomal plasmid integration with sodium tellurite (38). Plasmid construction is described in greater detail in Appendix S1 in the supplemental material.sgRNA design and cloning. A 20-nt base-pairing region (N20) of an sgRNA was designed using the Custom Dicer-Substrate siRNA (DsiRNA) tool (https://eu.idtdna.com/site/order/designtool/index/crispercustom). The sgRNA fragments with N20 were amplified with primers AATACTAGT-N20- GTTTTAGAGCTAGAAATAGC and GGACTGCAGGCAACGTTCAA (restriction sites are underlined) using pISApl1-CRISPR/Cas9 plasmid as the template. The PCR products were successively ligated to predigested pISApl1-CRISPR/Cas9 plasmid at the SpeI and PstI sites, generating pISApl1-CRISPR/Cas9 plasmids containing sgRNAs specific for mcr-1 and IncX4. The cloning procedure of the targeted sgRNA into the pISApl1-CRISPR/Cas9 was shown in Fig. S3 in the supplemental material.Transposition assays. The transposition was evaluated by the biparental mating assay with the pISApl1-CRISPR/Cas9-bearing E. coli WM3064 as the donor. In brief, donor strains were grown overnight at 37°C in LB supplemented with 300 μM DAP, and recipients were cultivated until the early stationary phase. Donors and recipients (100 μl of each) were combined in 700 μl LB and then centrifuged for 2 min at 7,000 × g. The cell pellets were washed with phosphate-buffered saline (PBS) three times and then resuspended in 50 μl LB. The mixture was, after that, transferred onto an MF HAWG01300 cellulose membrane (Millipore, Burlington, MA, USA) and placed on the prewarmed LB agar and incubated at 37°C for 12 h. The transconjugants were liberated from the membrane by vortexing in PBS and then serially diluted and plated on ST25 LB and antibiotic-free LB agar plates to calculate the transposition efficiency. To calculate the viable cell CFU of the plasmid-harboring mcr-1 and chromosome-harboring mcr-1 strains, the transconjugants were then serially diluted and plated on ST25 LB agar plates or CS2+ST25 LB agar plates.In vitro plasmid curing efficiency evaluation. The strains E. coli CSZ4 and E. coli C600(pUC19-mcr-1), which naturally or artificially harbored the mcr-1 gene and the E. coli C600 strain, were used in the conjugation assay to assess the plasmid curing and transposition efficiency of pISApl1-CRISPR/Cas9-mcr-1. To confirm the loss of the pCSZ4 and pUC19-mcr-1 in the successful transformants, fifty colonies grown on ST25 plates were randomly selected and subjected to PCR detection using primers IncX4-TF+IncX4-TR and mcr-TF+mcr-TR targeting the replication gene and mcr-1 gene of pCSZ4, respectively, and the primers UC19-TF+UC19-TR and mcr-TF+mcr-TR targeting the replication gene and mcr-1 gene of pUC19-mcr-1, respectively. The plasmid curing efficiency was calculated based on the PCR detection results. The experiments were technically repeated twice with three biological replicates.In vitro sequence-specific bacterial killing using pISApl1-CRISPR/Cas9. To test the bacterial killing capacity of ISApl1-CRISPR/Cas9, the pISApl1-CRISPR/Cas9 targeting mcr-1 was introduced into E. coli MG1655-MCR by conjugation, and the viable cells after treatment were calculated from the ST25 or ST25+CS2 agar plates. The experiments were technically repeated twice with three biological replicates.Sequencing of escape mutants. For plasmid curing, the transformants spread on LB agar plates with ST25 were verified by genotypes and phenotypes. Through PCR, we noticed that a minimal number of colonies were positive and that these colonies could grow on the agar plate of CS2. Then genomic DNA was extracted from escape mutants using a TIANamp bacteria DNA kit (Tiangen, Beijing, China). The Cas9+sgRNA containing regions of each escape mutant were amplified using primers mut-Cas9F and mut-Cas9R and subjected to DNA sequencing.The ISApl1-CRISPR/Cas9 system preventing plasmid acquisition. In this section, we used the plasmid-cured strain E. coli C600(ISApl1-CRISPR/Cas9) as the recipient in conjugation assay to see whether the integration of ISApl1-CRISPR/Cas was able to impede the acquisition of mcr-1 from model strains, and the donors were E. coli CSZ4, Salmonella enterica 19E0341, and Klebsiella pneumoniae YZ01, respectively. The conjugation assay was performed as described above. The blockade of mcr-1 transfer was evaluated by conjugation efficiency. The experiments were twice technically repeated with at least three biological replicates.Accession number(s). The complete nucleotide sequence of pISApl1-CRISPR/Cas9 was deposited in GenBank under accession number {"type":"entrez-nucleotide","attrs":{"text":"MW811192","term_id":"2073960094","term_text":"MW811192"}}MW811192.

Article TitleA Transposon-Associated CRISPR/Cas9 System Specifically Eliminates both Chromosomal and Plasmid-Bornemcr-1inEscherichia coli

Abstract

The global spread of antimicrobial-resistant bacteria has been one of the most severe threats to public health. The emergence of themcr-1gene has posed a considerable threat to antimicrobial medication since it deactivates one last-resort antibiotic, colistin. There have been reports regarding the mobilization of themcr-1gene facilitated by ISApl1-formed transposon Tn6330and mediated rapid dispersion amongEnterobacteriaceaespecies. Here, we developed a CRISPR/Cas9 system flanked by ISApl1in a suicide plasmid capable of exerting sequence-specific curing against themcr-1-bearing plasmid and killing the strain with chromosome-bornemcr-1. The constructed ISApl1-carried CRISPR/Cas9 system either restored sensitivity to colistin in strains with plasmid-bornemcr-1or directly eradicated the bacteria harboring chromosome-bornemcr-1by introducing an exogenous CRISPR/Cas9 targeting themcr-1gene. This method is highly efficient in removing themcr-1gene fromEscherichia coli, thereby resensitizing these strains to colistin. The further results demonstrated that it conferred the recipient bacteria with immunity against the acquisition of the exogenousmcr-1containing the plasmid. The data from the current study highlighted the potential of the transposon-associated CRISPR/Cas9 system to serve as a therapeutic approach to control the dissemination ofmcr-1resistance among clinical pathogens.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.