Materials and Methods

CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications inSaccharomyces cerevisiae

Strains, growth conditions and storage

The S. cerevisiae strains used in this study (Table ​(Table1)1) share the CEN.PK genetic background (Entian and Kötter 2007; Nijkamp et al. 2012). Shake flask cultures were grown at 30 °C in 500 mL flasks containing 100 mL synthetic medium (SM) (Verduyn et al. 1992) with 20 g·L−1 glucose in an Innova incubator shaker (New Brunswick Scientific, Edison, NJ, USA) set at 200 rpm. When required, auxotrophic requirements were complemented via addition of 150 mg·L−1 uracil, 100 mg·L−1 histidine, 500 mg·L−1 leucine, 75 mg·L−1 tryptophan (Pronk, 2002) or by growth in YP medium (demineralized water, 10 g·L−1 Bacto yeast extract, 20 g·L−1 Bacto peptone). As a carbon source, 20 g·L−1 glucose was used. Frozen stocks were prepared by addition of glycerol (30% v/v) to exponentially growing shake-flask cultures of S. cerevisiae and overnight cultures of Escherichia coli and stored aseptically in 1 mL aliquots at –80 °C.

Table 1.

Saccharomyces cerevisiae strains used in this study.

Name (Accession no.)Relevant genotypeParental strainOriginCEN.PK113-7DMAT_a _URA3 TRP1 LEU2 HIS3_P. KötterCEN.PK113-5D_MAT_a _ura3-52 TRP1 LEU2 HIS3_P. KötterCEN.PK122_MAT_a/_MATα URA3/URA3 TRP1/TRP1 LEU2/LEU2 HIS3/HIS3_P. KötterCEN.PK2-1C_MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ_P. KötterCEN.PK115_MAT_a/_MATα ura3-52/ura3-52 TRP1/TRP1 LEU2/LEU2 HIS3/HIS3_P. KötterIMX585 (Y40592)_MAT_a _can1Δ::cas9-natNT2 URA3 TRP1 LEU2 HIS3_CEN.PK113-7DThis studyIMX581 (Y40593)_MAT_a _ura3-52 can1Δ::cas9-natNT2 TRP1 LEU2 HIS3_CEN.PK113-5DThis studyIMX664 (Y40594)_MAT_a/_MATα CAN1/can1Δ::cas9-natNT2 URA3/URA3 TRP1/TRP1 LEU2/LEU2 HIS3/HIS3_CEN.PK122This studyIMX672 (Y40595)_MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2_CEN.PK2-1CThis studyIMX673 (Y40596)_MAT_a/_MATα ura3-52/ ura3-52 CAN1/can1Δ::cas9-natNT2 TRP1/TRP1 LEU2/LEU2 HIS3/HIS3_CEN.PK115This studyIMX711_MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2 mch1Δ pMEL10-_gRNA-_MCH1_IMX672This studyIMX712_MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2 mch2Δ pMEL10-_gRNA-_MCH2_IMX672This studyIMX713_MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2 mch5Δ pMEL10-_gRNA-_MCH5_IMX672This studyIMX714_MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2 mch1Δ mch5Δ pMEL10-_gRNA-_MCH1 pMEL10-_gRNA-_MCH5_IMX672This studyIMX715_MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2 itr1Δ pdr12Δ pUDR005IMX672This studyIMX716MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2 mch1Δ mch2Δ itr1Δ pdr12Δ pUDR002 pUDR005IMX672This studyIMX717MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2 mch1Δ mch2Δ mch5Δ aqy1Δ itr1Δ pdr12Δ pUDR002 pUDR004 pUDR005IMX672This studyIMX718MAT_a _ura3-52 trp1-289 leu2-3,112 his3Δ can1Δ::cas9-natNT2 GET4G315C NAT1C1139G pUDR020IMX672This studyIMX719MAT_a _can1Δ::cas9-natNT2 URA3 TRP1 LEU2 HIS3 acs1Δ acs2Δ::_(pADH1-aceF-tPGI1 pPGI1-lplA2-tPYK1 pPGK1-lplA-tPMA1 pTDH3-pdhB-tCYC1 pTEF1-lpd-tADH1 pTPI1-pdhA-tTEF1)_IMX585This studyOpen in a separate window

Strains with an accession number have been deposited at Euroscarf (http://web.uni-frankfurt.de/fb15/mikro/euroscarf/).

Plasmid construction

Construction of the single gRNA plasmid series (pMEL10–pMEL17)

The single gRNA plasmids (pMEL10–pMEL17) were constructed via Gibson assembly (New England Biolabs, Beverly, MA, USA) of a marker cassette with one fragment containing both the gRNA CAN1.Y (DiCarlo et al. 2013b) and the 2 μm replication sequence. This fragment was obtained by PCR from plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t, using primers 6845 & 6846 (Table S1, Supplementary data). The various marker cassettes were PCR amplified from plasmid templates pUG72, pUG-amdSYM, pUG-hphNT1, pUG6, pUG73 and pUG-natNT2 with primers 3093 & 3096 resulting in the KlURA3, amdSYM, hphNT1, kanMX, KlLEU2 and natNT2 cassettes, respectively. The HIS3 and TRP1 cassettes were obtained by PCR with primers 6847 & 6848 on plasmid templates pRS423 and pRS424. Assembly of the single gRNA plasmids was done by combining the appropriate marker cassette with the backbone containing the gRNA CAN1.Y and 2 μm sequences in a Gibson assembly reaction, following the manufacturer's recommendations. For each single gRNA plasmid (pMEL10–pMEL17), an E. coli clone containing the correctly assembled plasmid (confirmed by restriction analysis) was selected, stocked and deposited at EUROSCARF (http://web.uni-frankfurt.de/fb15/mikro/euroscarf/).

Construction of the double gRNA plasmid series (pROS10 – pROS17)

To construct the double gRNA plasmids (pROS10–pROS17), an intermediate plasmid was first constructed, carrying two gRNA cassettes that both targeted CAN1.Y (DiCarlo et al. 2013b). This intermediate plasmid was assembled out of four different overlapping fragments: the two gRNA cassettes overlapping with each other in the 2 μm replicon, one URA3 marker cassette and a cassette containing all sequences for amplification in E. coli. The gRNA cassettes were obtained in a two-step PCR approach. First, a 2 μm fragment was obtained from pUD194 (Table ​(Table2)2) with primers 3289 & 4692 and two different gRNA cassettes were PCR amplified from p426-SNR52p-gRNA.CAN1.Y-SUP4t with primers 5972 & 5976 for the first cassette and 5977 & 5973 for the second cassette. Each gRNA cassette was separately pooled with the 2 μm fragment and in a second PCR reaction, the gRNA cassettes were extended with either the 5′ or 3′ halve of the 2 μm fragment, resulting in two different gRNA cassettes, overlapping in the 2 μm sequence, by using primer pair 5975 & 4068 for the first and 5974 & 3841 for the second fragment. The marker fragment containing URA3 was obtained from pUD192 with primers 3847 & 3276 (Table ​(Table2)2) and the fragment containing all sequences for amplification in E. coli was PCR amplified from pUD195 (Table ​(Table2)2) with primers 3274 & 3275. Using Gibson assembly, the four overlapping fragments were assembled into the intermediate plasmid pUDE330. To obtain pROS10, pUDE330 was linearized by PCR amplification of the backbone, excluding the gRNA fragments, and co-transformed with two gRNA cassettes for in vivo assembly by HR in yeast (Kuijpers et al. 2013b). For linearizing the backbone, a single primer was used (5793) and the gRNA fragments were obtained by PCR from pUDE330 with primers 6008 & 5975 and 6007 & 5974. The plasmid was extracted from yeast and transformed into E. coli for storage and plasmid propagation. The other double gRNA plasmids were assembled by the Gibson assembly method with a marker cassette and the pROS10 plasmid backbone fragment. This backbone fragment was obtained by linearization of pROS10 with restriction enzymes Pvu_II and _Not_I. The various marker cassettes were PCR amplified from plasmid templates pUG-amdSYM, pUG-hphNT1, pUG6, pUG73 and pUG-natNT2 with primers 3093 & 3096 resulting in the _amdSYM, hphNT1, kanMX, KlLEU2 and natNT2 cassettes, respectively. The HIS3 and TRP1 cassettes were obtained by PCR with primers 6847 & 6848 on plasmid templates pRS423 and pRS424. Combining the appropriate marker cassette with the pROS10 backbone fragment in a Gibson assembly reaction, following the manufacturer's recommendations, resulted in pROS11–pROS17. For each of these double gRNA plasmids, an E. coli clone containing the correctly assembled plasmid was selected, stocked and deposited at EUROSCARF (http://web.uni-frankfurt.de/fb15/mikro/euroscarf/).

Table 2.

Plasmids used in this study.

Name (Accession no.)Relevant characteristicsOriginpUG6Template for A-kanMX-B† cassette(Gueldener et al. 2002)pUG72Template for A-KlURA3-B cassette(Gueldener et al. 2002)pUG73Template for A-KlLEU2-B cassette(Gueldener et al. 2002)pUG-hphNT1Template for A-hphNT1-B cassette(de Kok et al. 2011)pUG-natNT2Template for A-natNT2-B cassette(de Kok et al. 2012)pUG-amdSYMTemplate for A-amdSYM-B cassette(Solis-Escalante et al. 2013)pRS423Template for A-HIS3-_B cassette(Christianson _et al. 1992)pRS424Template for A-TRP1-B cassette(Christianson et al. 1992)p414-TEF1p-Cas9-CYC1tCEN6/ARS4 ampR TRP1 pTEF1-cas9-tCYC1(DiCarlo et al. 2013a)p426-SNR52p-gRNA.CAN1.Y-SUP4t2μm ampR URA3 gRNA-CAN1.Y(DiCarlo et al. 2013a)pUD192pUC57 + URA3(Kozak et al. 2014a)pUD194pUC57 + 2μm(Kozak et al. 2014a)pUD195pUC57 + pMB1 + ampR(Kozak et al. 2014a)pUD301pUC57 + pTPI1-pdhA E. faecalis-tTEF1(Kozak et al. 2014a)pUD302pUC57 + pTDH3-pdhB E. faecalis -tCYC1(Kozak et al. 2014a)pUD303pUC57 + pADH1-aceF E. faecalis -tPGI1(Kozak et al. 2014a)pUD304pUC57 + pTEF1-lpd E. faecalis -tADH1(Kozak et al. 2014a)pUD305pUC57 + pPGK1-lplA E. faecalis -tPMA1(Kozak et al. 2014a)pUD306pUC57 + pPGI1-lplA2 E. faecalis -tPYK1(Kozak et al. 2014a)pUDE3302μm ampR URA3 gRNA-CAN1.Y 2xThis studypMEL10 (P30779)2μm ampR KlURA3 gRNA-CAN1.YThis studypMEL11 (P30780)2μm ampR amdSYM gRNA-CAN1.YThis studypMEL12 (P30781)2μm ampR hphNT1 gRNA-CAN1.YThis studypMEL13 (P30782)2μm ampR kanMX gRNA-CAN1.YThis studypMEL14 (P30783)2μm ampR KlLEU2 gRNA-CAN1.YThis studypMEL15 (P30784)2μm ampR natNT2 gRNA-CAN1.YThis studypMEL16 (P30785)2μm ampR HIS3 gRNA-CAN1.YThis studypMEL17 (P30786)2μm ampR TRP1 gRNA-CAN1.YThis studypROS10 (P30787)2μm ampR URA3 gRNA-CAN1.Y gRNA-ADE2.YThis studypROS11 (P30788)2μm ampR amdSYM gRNA-CAN1.Y gRNA-ADE2.YThis studypROS12 (P30789)2μm ampR hphNT1 gRNA-CAN1.Y gRNA-ADE2.YThis studypROS13 (P30790)2μm ampR kanMX gRNA-CAN1.Y gRNA-ADE2.YThis studypROS14 (P30791)2μm ampR KlLEU2 gRNA-CAN1.Y gRNA-ADE2.YThis studypROS15 (P30792)2μm ampR natNT2 gRNA-CAN1.Y gRNA-ADE2.YThis studypROS16 (P30793)2μm ampR HIS3 gRNA-CAN1.Y gRNA-ADE2.YThis studypROS17 (P30794)2μm ampR TRP1 gRNA-CAN1.Y gRNA-ADE2.YThis studypUDR0022μm ampR TRP1 gRNA-MCH1 gRNA-MCH2_This studypUDR0042μm ampR _HIS3 gRNA-MCH5 gRNA-AQY1_This studypUDR0052μm ampR _URA3 gRNA-ITR1 gRNA-PDR12_This studypUDR0202μm ampR _URA3 gRNA-NAT1 gRNA-GET4_This studypUDR0222μm ampR _kanMX gRNA-ACS1 gRNA_-ACS2_This studyOpen in a separate window

†A and B refer to 60 bp tags that are incorporated via PCR, enabling homologous recombination.

Plasmid with an accession number have been deposited at Euroscarf (http://web.uni-frankfurt.de/fb15/mikro/euroscarf/).

Strain construction

Saccharomyces cerevisiae strains were transformed according to Gietz and Woods (2002). Mutants were selected on solid YP medium (demineralized water, 10 g·L−1 Bacto yeast extract, 20 g·L−1 Bacto peptone, 2% (w/v) agar), supplemented with 200 mg·L−1 G418, 200 mg·L−1 hygromycin B or 100 mg·L−1 nourseothricin (for dominant markers) or on SM supplemented with appropriate auxotrophic requirements (Verduyn et al. 1992). In all cases, gene deletions and integrations were confirmed by colony PCR on randomly picked colonies, using the diagnostic primers listed in Table S1 (Supplementary data). Integration of cas9 into the genome was achieved via assembly and integration of two cassettes containing cas9 and the natNT2 marker into the CAN1 locus. The cas9 cassette was obtained by PCR from p414-TEF1p-cas9-CYC1t (DiCarlo et al. 2013b), using primers 2873 & 4653. The natNT2 cassette was PCR amplified from pUG-natNT2 with primers 3093 & 5542. 2.5 μg cas9 and 800 ng natNT2 cassette were pooled and used for each transformation. Correct integration was verified by colony PCR (Supplementary data) using the primers given in Table S1 (Supplementary data), the resulting strains have been deposited at EUROSCARF. IMX719 was constructed by co-transformation of pUDR022 (see below) with genes required for functional Enterococcus faecalis PDH expression (Kozak et al. 2014b). The gene cassettes were obtained by PCR using plasmids pUD301–pUD306 as template (Table ​(Table2)2) with the primers indicated in Table S1 (Supplementary data) and the ACS1 dsDNA repair fragment, obtained by annealing two complementary single-stranded oligos (6422 & 6423). After confirmation of the relevant genotype (Fig. 4B), the pUDR022 plasmid was removed as explained in Supplementary data.

Figure 4.

Multiplexing CRISPR/Cas9 in S. cerevisiae. (a) Chromosomal integration of the six genes required for expression of a functional E. faecalis pyruvate dehydrogenase complex in the yeast cytosol. All six genes are flanked by 60 bp sequences enabling HR (indicated with black crosses). The first and the last fragments are homologous to 60 bp just up- and downstream of the ACS2 ORF, respectively, thus enabling repair of the Cas9-induced double strand break by HR (left panel). Deletion of ACS1 using a 120 bp dsDNA repair fragment is shown in the right panel. (b) Multiplex colony PCR was performed on 10 transformants to check their genotypes. Results are shown for two representative colonies, confirming the intended genotype. The PCR on the wild-type strain (CEN.PK113-7D) shows the predicted bands for the presence of the wild-type ACS1 and ACS2 alleles. Two DNA ladders were used; L1 refers to the GeneRuler DNA ladder (Thermo Scientific) and L2 to the GeneRuler 50 bp DNA ladder (Thermo Scientific). (The bands indicated with an asterisk reflect aspecific PCR products).

Single gRNA method (cloning-free)

The yeast HR machinery was used to assemble plasmids with specific gRNA sequences out of two different fragments: a plasmid backbone and a gRNA target sequence. Depending on the preferred selectable marker, the linearized plasmid backbone was obtained via PCR using the appropriate single gRNA plasmid (pMEL10–pMEL17) as a template, with primers 6005 & 6006. To obtain the double-stranded gRNA cassettes (the target sequences are listed in Table ​Table3),3), two complementary single-stranded oligos (Table S1, Supplementary data) were mixed in a 1:1 molar ratio, heated to 95°C and then cooled down to room temperature. The resulting gRNA fragments contained the 20 bp gRNA recognition sequences, flanked by 50 bp overlaps with the linearized plasmid backbone. The 120 bp repair fragments were obtained by following the same procedure and were identical to the up- and downstream regions of the DSB break, allowing for effective repair by the HR-machinery. For each transformation, a linearized plasmid backbone, a double-stranded cassette containing the gRNA sequence of choice and the double-stranded DNA cassette for repair of the DSB were pooled and co-transformed to the appropriate strain.

Table 3.

Target sequences used in this study.

LocusSequence (including PAM)Restriction siteAT scoreRNA score_MCH1_TATTGGCAATAAACATCTCGAGG0.650.50_MCH2_ATCTCGATCGAGGTGCCTGATGG_Pvu_I0.450.30_MCH5_ACTCTTCCGTTTTAGATATCTGG_Eco_RV0.650.50_AQY1_ACCATCGCTTTAAAATCTCTAGG_Dra_I0.650.50_ITR1_ATACATCAACGAATTCCAACCGG_Eco_RI0.650.60_PDR12_GCATTTTCGGTACCTAACTCCGG_Kpn_I0.550.65_NAT1_AAAGGAATTGGATCCTGCGTAGG_Bam_HI0.550.60_GET4_GGGCTCGCTAGGATCCAATTCGG_Bam_HI0.450.50_ACS1_TTCTTCACAGCTGGAGACATTGG_Pvu_II0.550.45_ACS2_TCCTTGCCGTTAAATCACCATGG0.550.75Open in a separate window

Double gRNA method

Plasmids with two gRNAs were assembled in vitro, using Gibson assembly of a 2 μm fragment containing the two gRNA sequences and a double gRNA (pROS10–pROS17) plasmid backbone. The 2 μm fragment was obtained via PCR, using pROS10 as a template with two primers containing the 20 bp gRNA recognition sequences and a 50 bp sequence, homologous to the linearized plasmid backbone (Table S1, Supplementary data). The linearized plasmid backbone was obtained via PCR using one of the double gRNA plasmids (pROS10–pROS17, depending on the preferred selective marker) as a template with a single primer (6005), binding at each of the two SNR52 promoters (Supplementary data). The two fragments were combined using Gibson assembly, followed by transformation to E. coli for storage and plasmid propagation. Since both of the gRNA containing primers could bind on either side of the 2 μm fragment, it was important to check that the final plasmid contained one copy of each gRNA (theoretically this would be the case in 50% of the E. coli transformants). To simplify this confirmation step, the gRNA target sequences were selected for the presence of a restriction site. Alternatively, diagnostic primers specific for the introduced 20 bp recognition sequences were used for the identification of correctly assembled gRNA plasmids using PCR (see Protocol in Supplementary data).

To construct the plasmid pUDR002 (targeting MCH1&MCH2, TRP1 marker), the 2 μm fragment was amplified using DreamTaq (Fisher Scientific) from pROS10 using primers 6835 & 6837 (Supplementary data). The backbone of pROS17 was amplified using the Phusion polymerase (Fisher Scientific) with a single primer 6005 (Supplementary data). The two fragments were assembled using Gibson assembly and confirmed via restriction analysis. Similarly, the following plasmids were constructed: pUDR004 (targeting MCH5&AQY1, HIS3 marker), pUDR005 (targeting ITR1&PDR12, KlURA3 marker), pUDR020 (targeting NAT1&GET4, URA3 marker) and pUDR022 (targeting ACS1&ACS2, kanMX marker). Transformations using the double gRNA method required co-transformation of 2 μg of (each) pUDR plasmid together with 1 μg of (each) corresponding double-stranded DNA cassette for DSB repair.

Molecular biology techniques

PCR amplification with Phusion® Hot Start II High Fidelity Polymerase (Thermo Fisher Scientific) was performed according to the manufacturer's instructions using PAGE-purified oligonucleotide primers (Sigma-Aldrich, St. Louis, MO, USA). Diagnostic PCR was done via colony PCR on randomly picked yeast colonies, using DreamTaq (Thermo Fisher Scientific) and desalted primers (Sigma-Aldrich). The primers used to confirm successful deletions by one of the two described methods can be found in Table S1 (Supplementary data). DNA fragments obtained by PCR were separated by gel electrophoresis on 1% (w/v) agarose gels (Thermo Fisher Scientific) in TAE buffer (Thermo Fisher Scientific) at 100 V for 30 minutes. Fragments were excised from gel and purified by gel purification (Zymoclean™, D2004, Zymo Research, Irvine, CA, USA). Plasmids were isolated from E. coli with Sigma GenElute Plasmid kit (Sigma-Aldrich) according to the supplier's manual. Yeast plasmids were isolated with Zymoprep Yeast Plamid Miniprep II Kit (Zymo Research). Escherichia coli DH5α (18258–012, Life Technologies) was used for chemical transformation (T3001, Zymo Research) or for electroporation. Chemical transformation was done according to the supplier's instructions. Electrocompetent DH5α cells were prepared according to Bio-Rad's protocol, with the exception that the cells were grown in LB medium without NaCl. Electroporation was done in a 2 mm cuvette (165–2086, Bio-Rad, Hercules, CA, USA) using a Gene Pulser Xcell Electroporation System (Bio-Rad), following the manufacturer's protocol.

Yeastriction webtool

The tool is written in Javascript and based on the MEAN.io stack (MongoDB, Express, AngularJS and Node.js). The source code is available at https://github.com/hillstub/Yeastriction. Genome and ORF sequences were downloaded from SGD (http://www.yeastgenome.org) in GFF and FASTA file format, respectively. ORFs, including their 1 kb up- and downstream sequences, were extracted and imported into Yeastriction, with the aid of an in-house script.

Yeastriction extracts all possible Cas9 target sequences (20 bp followed by NGG) from a specified ORF and from its complementary strand. Subsequently, sequences containing six or more Ts are discarded as this can terminate transcription (Braglia, Percudani and Dieci 2005; Wang and Wang 2008). Target sequences are then tested for off-targets (an off-target is defined as a sequence with either the NGG or NAG PAM sequence and 17 or more nucleotides identical to the original 20 bp target sequence; Hsu et al. 2013) by matching the sequences against the reference genome using Bowtie (version 1) (Langmead et al. 2009). If any off-target is found, the original target sequence is discarded. In a next step, the AT content is calculated for the target sequence. Using the RNAfold library (essentially with the parameters –MEA –noLP –temp = 30.) (Lorenz et al. 2011), the maximum expected accuracy structure of each RNA molecule is calculated. The target sequence is also searched for the presence of restriction sites based on a default list or a user-defined list. The targets can be ranked based on the presence of restriction sites (1 for containing and 0 for lacking a restriction site), AT content (1 having the highest AT content and 0 for the lowest AT content) and secondary structure (1 having the lowest amount of pairing nucleotides and 0 for the highest number of nucleotides involved in secondary structures, indicated by brackets). The range for every parameter is determined per locus and used to normalize the values. Subsequently, the target sequences are ranked by summation of the score for each parameter. These ranking scores should only be used to order the targets from a single locus and not to compare targets for different loci. The application can be accessed at the following URL: http://yeastriction.tnw.tudelft.nl/.

Go to:

Article TitleCRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications inSaccharomyces cerevisiae

Abstract

A variety of techniques for strain engineering inSaccharomyces cerevisiaehave recently been developed. However, especially when multiple genetic manipulations are required, strain construction is still a time-consuming process. This study describes new CRISPR/Cas9-based approaches for easy, fast strain construction in yeast and explores their potential for simultaneous introduction of multiple genetic modifications. An open-source tool (http://yeastriction.tnw.tudelft.nl) is presented for identification of suitable Cas9 target sites inS. cerevisiaestrains. A transformation strategy, usingin vivoassembly of a guideRNA plasmid and subsequent genetic modification, was successfully implemented with high accuracies. An alternative strategy, usingin vitroassembled plasmids containing two gRNAs, was used to simultaneously introduce up to six genetic modifications in a single transformation step with high efficiencies. Where previous studies mainly focused on the use of CRISPR/Cas9 for gene inactivation, we demonstrate the versatility of CRISPR/Cas9-based engineering of yeast by achieving simultaneous integration of a multigene construct combined with gene deletion and the simultaneous introduction of two single-nucleotide mutations at different loci. Sets of standardized plasmids, as well as the web-based Yeastriction target-sequence identifier and primer-design tool, are made available to the yeast research community to facilitate fast, standardized and efficient application of the CRISPR/Cas9 system.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.