Materials and Methods

Harnessing Type I and Type III CRISPR-Cas systems for genome editing

MATERIALS AND METHODSStrains, growth conditions and transformation of SulfolobusGenetic hosts and mutants constructed in this work are listed in Table ​Table1.1. Sulfolobus strains were grown at 78°C in a Sucrose-Casamino acids-Vitamin (SCV) medium (0.2% sucrose, 0.2% casamino acids plus 1% vitamin solution) or SCVy (SCV + yeast extract (0.0025%)) (43) and uracil was supplemented to 20 μg/ml if required. Sulfolobus competent cells were prepared as previously described (43) and transformed by electroporation. All oligonucleotides (Table 2) were synthesized in Tsingke, Wuhan, China, and restriction enzymes were purchased from ThermoFischer Scientific, Waltham, MA, USA.Table 1.Strains and plasmids used in this workStrainsGenotype and featuresReferenceS. islandicus E233ΔpyrEFDeng et al. (27)S. islandicus Δcas3Derived from S. islandicus E233S1, carrying deletion of the entire gene of cas3Peng et al. (37)S. islandicus Δcmr-βDerived from S. islandicus E233, carrying deletion of IIIB Cmr-β locus including 7 cmr-β genesThis workS. islandicus ΔlacSDerived from S. islandicus E233, carrying 43 bp deletion in the lacS geneThis workS. islandicus Cmr-2α-HisDerived from S. islandicus E233, carrying the cmr-2α-His geneThis workS. islandicus Cmr-2α-HDmut1, 2, 3Derived from S. islandicus Δcmr-β, carrying one or more mutations in the HD domain of cmr-2αThis workpSe-RpContained a DNA fragment of two tandem copies of CRISPR repeat used for construct an artificial mini-CRISPR lociPeng et al. (38)pAC-lacS1pSe-Rp carried a CRISPR locus with a spacer matching a protospacer in the lacS gene of S. islandicusThis workpGE-lacS1A genome-editing plasmid derived from pAC-lacS, carrying donor DNA lacking the target site of the plasmid-born CRISPRThis workpGE-2α-HisA genome editing plasmid, carrying an artificial mini-CRISPR locus with a spacer derived from the stop codon region of cmr-2α and a donor DNA containing the coding sequence of the tandem 6 Hisditine residues before the stop codon of the target geneThis workpGE-2αHDA genome editing plasmid, carrying an artificial mini-CRISPR with a spacer derived from the coding sequence of the HD domain and a donor DNA for HD domain harboring multiple mutations in the HD domain of the cmr-2α geneThis workOpen in a separate windowTable 2.Oligonucleotides used in this workOligonucleotideSequence (5′–3′)LacS-E-SpFAAAGAGTGTAGTAATTAACACCAATCCAGTCTAACCTACCCCTTLacS-E-SpRTAGCAAGGGGTAGGTTAGACTGGATTGGTGTTAATTACTACACTLacS-E-SOEFGGGAGGGAGAAGGTTGTGAGAGATGATTTACTGTAGTTAAGAAGACCGAAAAGGGATALacS-E-SOERTATCCCTTTTCGGTCTTCTTAACTACAGTAAATCATCTCTCACAACCTTCTCCCTCCCLacS-E-SalIFACGCGTCGACTAAACATGTACCATTGGCCCLacS-E-NotIRATAAGAATGCGGCCGCCCTTAATGGTCTTATAGGTGF1AACTGGCGGTACATAGTGGTAR1GGGTAGAAGTGTGTATGAGF2GTACAACATTATTCAAGCTCR2TTTGATAATCTGCATCATCCLacS-Seq-FGTGGCTAAATTAACCGATACLacS-Seq-RGGCATACTATAAGAGGCAAGG2α-His-SpFAAAGAATACATGTTTGCTCACCTTAAGTAAGATACT2α-His-SpRTAGCAGTATCTTACTTAAGGTGAGCAAACATGTATT2α-His-SOEFATCTTACTTAAGGCATCATCACCATCACCATTGAGCAAACATGTATTTGCTAATAA2α-His-SOERATGGTGATGATGCCTTAAGTAAGATACTGCGTAAATTATACTAAGGAACGTTTCTT2α-His-SalIFACGCGTCGACGGATTTAAGTCATATGCAG2α-His-NotIRATAAGAATGCGGCCGCCTTTTTGGTTTCCCCATTCTACF3GTAAAGTGTAAAGAAGGAACR3ATGGTGATGGTGATGATG2α-HDmut-SpFAAAGCGACCCTCCTTGGAAGGCATGGGTAATTACAAGGAATATT2α-HDmut-SpRTAGCAATATTCCTTGTAATTACCCATGCCTTCCAAGGAGGGTCG2α-HDmut-SOEFCAACCCTCCTTGGGCCGCATGGGTAGCAACAAGGAATATTAGGGAAGGTCAC2α-HDmut-SOERCCCATGCGGCCCAAGGAGGGTTGTTAAAATAGGCTATTATTTTCTTATTTAAG2α-HDmut-SalIFACGCGTCGACTAAGGAAAAAGCGATGAGAC2α-HDmut-NotIRATAAGAATGCGGCCGCGTTCCTTCTTTACACTTTAC2α-Seq-FCCCAATTATTACAATCCTTC2α-Seq-RCACTTGAATACTACCGAACCOpen in a separate window1. Restriction sites are underlined whereas 4 nt protruding ends of spacer fragments after primer annealing are shown in bold face.2. Point mutations in HD domain sequence of cmr-2α are highlighted in red.Construction of genome-editing plasmids (pGE)Genome-editing plasmids (pGE) (Table ​(Table1)1) were constructed individually by cloning a single spacer and a mutant allele of the target gene into pSe-Rp, a Sulfolobus CRISPR-cloning vector (38). Spacer fragments were generated by annealing of the corresponding complementary oligonucleotides (Table ​(Table2)2) and inserted into pSe-Rp at the BspMI sites, yielding plasmids carrying an artificial mini-CRISPR array. Then, donor DNA fragments containing a mutant allele of each target gene were obtained by splicing and overlap extension PCR (44) using primers listed in Table ​Table2.2. The PCR products were digested with Sal I and Not I, and purified again. The resulting restriction DNA fragments were inserted into their cognate pAC plasmids at the same sites, giving pGE plasmids listed in Table ​Table11.Mutant construction and screening of mutated gene alleles by PCREach pGE plasmid was introduced into a S. islandicus host indicated in each experiment by electroporation. After transformation, pGE plasmids mediated self targeting to the chromosome of wild-type cells and kill them. Only mutants can survive the transformation and form colonies on SCV plates since their chromosomes are devoid of the target sequence. Transformants were screened by PCR amplification of the wild-type target gene and its mutated allele using primers listed in Table ​Table2.2. The resulting PCR products were analyzed by agarose gel electrophoresis and by DNA sequencing (Tsingke, Wuhan, China).X-gal assayβ-Glycosidase activity encoded by lacS gene was detected in colonies of Sulfolobus strains by spraying an X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside) solution of 2 mg/ml onto the colonies on plates and incubating for a few hours at 78°C. To detect the enzyme activity in liquid cultures, X-gal was added to 2 mg/ml (final concentration) and incubated in a 78°C incubator for 1 h before observation. Colonies or cultures exhibiting the enzymatic activity show a deep blue color while those that remain colorless are lacS mutants.Western blottingS. islandicus Cmr-2α-His strain was cultured in SCVy medium. When the absorbance at 600 nm of the culture reached 0.4, cell mass was collected by centrifugation, re-suspended in 50 mM phosphate buffer and sonicated. Then, crude protein samples were loaded on 12% SDS-PAGE and fractionated according to their sizes. Fractionated proteins were transferred onto a nylon membrane using the Semi-Dry Electrophoretic Transfer Cell system (Bio-Rad; Hercules, CA, USA). The membrane was incubated with a hybridization buffer containing an antiserum against His-tag peptide (GenScript, Piscataway, NJ, USA) during which the antiserum bound to His-tagged Cmr-2α protein. The His-tag antiserum was then recognized by a secondary antibody (Goat Anti-Mouse IgG, GenScript) and the protein bands were visualized by chemiluminescent detection using the clarity Western ECL substrate (Bio-Rad; Hercules, CA, USA) and recorded using the MFChemibis 3.2 imaging device (DNR; Jerusalem, Israel).Co-purificationCell lysate was prepared from a large culture of S. islandicus Cmr-2α-His strain and centrifuged for 30 min at 12 000 rpm. The recombinant protein in the supernatant was purified by Nickel-chelate affinity chromatography (45). Briefly, 500 μl Ni-NTA-agarose (Qiagen, Hilden, Germany) was added to the supernatant and incubated at 4°C by rotating end-over-end for 30 min. Agarose beads were then washed with 10 ml Wash Buffer 1 (50 mM phosphate buffer, pH7.4, 500 mM NaCl, 20 mM Imidizole) and 10 ml Wash Buffer 2 (50 mM phosphate buffer, pH 7.4, 500 mM NaCl, 60 mM Imidizole). Recombinant protein was eluted using the Elution Buffer (50 mM phosphate buffer, pH 7.4, 500 mM NaCl, 200 mM Imidizole).

Article TitleHarnessing Type I and Type III CRISPR-Cas systems for genome editing

Abstract

CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are widespread in archaea and bacteria, and research on their molecular mechanisms has led to the development of genome-editing techniques based on a few Type II systems. However, there has not been any report on harnessing a Type I or Type III system for genome editing. Here, a method was developed to repurpose both CRISPR-Cas systems for genetic manipulation inSulfolobus islandicus, a thermophilic archaeon. A novel type of genome-editing plasmid (pGE) was constructed, carrying an artificial mini-CRISPR array and a donor DNA containing a non-target sequence. Transformation of a pGE plasmid would yield two alternative fates to transformed cells: wild-type cells are to be targeted for chromosomal DNA degradation, leading to cell death, whereas those carrying the mutant gene would survive the cell killing and selectively retained as transformants. Using this strategy, different types of mutation were generated, including deletion, insertion and point mutations. We envision this method is readily applicable to different bacteria and archaea that carry an active CRISPR-Cas system of DNA interference provided the protospacer adjacent motif (PAM) of an uncharacterized PAM-dependent CRISPR-Cas system can be predicted by bioinformatic analysis.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.