Materials and Methods

Spacer-length DNA intermediates are associated with Cas1 in cells undergoing primed CRISPR adaptation

MATERIALS AND METHODSStrains and plasmids Escherichia coli KD263 (K-12 F+, lacUV5-cas3 araBp8-cse1, CRISPR I: repeat-spacer g8-repeat, ΔCRISPR II) has been described (34). Escherichia coli KD454 is a derivative of KD263 carrying deletion of cas3 gene, it was obtained by recombineering (35). Escherichia coli AM7-7 is a derivative of KD263 carrying deletion of ihfA gene, it was obtained by P1-mediated transduction (36). Escherichia coli BW40297 has been described (21).Plasmids pG8 and pG8mut have been described previously (21). Plasmid pG8mut_CCG is pG8mut derivative containing CCG PAM instead of AAG PAM in front of hot protospacer 1 (GTGCTCATCATTGGAAAACGTTCTTCGGGGCGA). The mutation was introduced by standard site-directed mutagenesis protocol with primers HS1_CCG for and HS1_CCG rev (primer sequences are available in Supplementary Table S1).Antibody preparation and purificationA pET28-based expression plasmid for co-overproduction of N-terminalally 6-His-tagged Cas1 and untagged Cas2 was constructed by amplifying an E. coli genomic fragment containing cas1 and cas2 with appropriate primers and cloning under the inducible T7 RNAP promoter. Plasmid-borne cas genes were expressed in E. coli BL21 (DE3) strain in LB medium containing 30 μg/ml kanamycin. Cells were grown at 37°C until OD600 reached 0.6 followed by induction with 1 mM isopropyl 1-thio-β-d-galactopyranoside and further growth for 2 h. Cells were harvested by centrifugation for 20 min at 5000 × g at 4°C and frozen at −80°C. Cell pellets were resuspended in buffer A (20 mM Tris pH 8, 0.5 M NaCl) containing 1 mg/ml lysozyme. Cells were disrupted by sonication and cells lysate was clarified by centrifugation at 16 000 × g for 1 h and filtering through a 0.45 μm filter. The extract was loaded on a 1 ml Chelating HP column (GE Healthcare) loaded with Ni2+ and equilibrated with buffer A. The column was washed with buffer A containing 20 mM and 50 mM imidazole and bound proteins were eluted with 300 mM imidazole in buffer A. A gel showing material in eluted fractions is shown in Supplementary Figure S1A. Fractions 6 and 7 were pooled and used to immunize rats. Antisera were tested by Western blotting against material used for immunization and further purified on an affinity column containing recombinant Cas1 (purified as described above from cells expressing hexahistidine-tagged Cas1 only from a pET28 plasmid) immobilized on cyanogen bromide-activated sepharose (Sigma-Aldrich) according to manufacturer instructions. The reactivity of the antibody (1:5000 dilution) on a western blot against proteins from whole cell extracts of induced and uninduced KD263 E. coli cells is shown in Supplementary Figure S1B). While the final purified antibody preparation was reactive against Cas1, it pulled-down Cas2 from whole-cells extracts of induced cells (Supplementary Figure S1C). In vivo induction of CRISPR–Cas system Escherichia coli KD263, AM7-7, KD454 or BW40297 were transformed with pG8mut, pG8mut_CCG or pT7blue (Novagen) plasmids. Transformants were selected on LB agar plates containing 100 μg/ml ampicillin. Individual transformants were grown in liquid medium and induced as described (37). Three hours post-induction aliquots of induced and uninduced cultures were processed for ChIP or total DNA purification.Chromatin immunoprecipitation and real-time PCR quantificationTen milliliters of induced and uninduced cultures were harvested 3 hours post-induction. Chromatin immunoprecipitation procedure with purified antibody was performed as described with minimal modifications (38). In short, formaldehyde was added to cultures to final concentration 1% and incubated for 20 min at RT with rotation. Three biological replicates or every immunoprecipitation experiment were performed. The reaction was quenched by adding glycine (0.5 M final concentration) and incubated under same condition for 5 min. Twenty milliliters of cross-linked cells were pelleted by centrifugation and washed three times with TBS (pH 7.5). One milliliter of lysis buffer (10 mM Tris (pH 8.0), 20% sucrose, 50 mM NaCl, 10 mM EDTA, 20 mg/ml lysozyme and 0.1 mg/ml RNaseA) was added and samples were incubated at 37°C for 30 min. After adding of 4 ml of IP buffer (50 mM HEPES–KOH (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS and 1 mM PMSF) the samples were subjected to sonication on Vibra-Cell VCX130 machine (Sonics) at 80% power for 5 min yielding in DNA fragments of 200–300 bp length. This and later steps were performed on ice. After centrifugation, 800 μl of supernatant was preincubated with 20 μl of Protein A/G Sepharose beads (Thermoscientific) to pull down unspecific interactors with the resin and unbound fraction was combined with 30 μl of BSA-blocked Protein A/G Sepharose and 7 μl of anti-Cas1 antibody and incubated overnight on a rotary platform. Standard washing with IP buffer, high salt IP buffer, wash buffer and TE buffer and elution steps were performed as described (38). Immunoprecipitated samples and sheared input samples DNA were de-cross linked in 0.5× elution buffer containing 0.8 mg/ml Proteinase K at 42°C for 2 h followed by 65°C for 6 h. DNA was precipitated with glycogen and dissolved in 20 μl of MilliQ water. A typical yield of DNA yield was 40–60 ng. Each qPCR reaction was carried out in triplicate (technical repeats) in a 20 μl reaction volume with 0.8 units of HS Taq DNA polymerase (Evrogen) and 0.01 μl of Syto13 intercalating dye (LifeTechnology) using DTlite4 (DNA-Technology) amplifier. For each reaction, melting curves were analyzed to ensure amplicon quality and exclude primer dimer formation during amplification. Amplicons from qPCR reactions were cloned and, for each amplicon, several randomly chosen recombinant plasmids sequenced. In each case the cloned inserts size and sequence matched the expectation (Supplementary Table S2). Enrichment ratio ΔΔCt = ΔCt ind (mean Ct IP – mean Ct input) − ΔCt unind(mean Ct IP – mean Ct input) was determined. To convert ΔΔCt values to relative differences in amplicon concentrations a 2−ΔΔCt value was determined. 10 μl aliquots of ChIP material were treated with 5 units of TaiI/FaiI restriction endonucleases (ThermoScientific) following manufacturer's instructions. After precipitation, qPCR was conducted as described above. The fold enrichment between treated and untreated DNA was next calculated as 2−(ΔΔCttreated − ΔΔCtuntreated).Total DNA purification and analysisTotal DNA was prepared from cells collected from 2 ml of induced or uninduced cell cultures using Genomic DNA Purification Kit (ThermoScientific) following manufacturer's instructions and adding glycogen (ThermoScientific) during precipitation steps to promote recovery of short and singe-stranded DNA fragments. Total DNA (∼5 μg) was dissolved in 25 μl of deionized water. 10 μl aliquots were treated with 5 units of S1 nuclease (ThermoScientific) following manufacturer's instructions. After precipitation, qPCR was conducted as described above with three biological replicates performed. Normalization has been performed as follows: ΔCt = mean Ct sample – mean Ct gyr, where the latter term is obtained for amplification of a gyrA gene fragment.Spacer acquisition analysisAliquots of induced and uninduced total DNA samples were subjected to PCR with primers P4518 and P4581 annealing at both sides of the CRISPR array. The results were analyzed by agarose gel electrophoresis. To analyze the pattern of newly acquired spacers the PCR product corresponding to expanded CRISPR array was gel purified with QIAquick Gel Extraction Kit (QIAGEN) and sequenced using Miseq Illumina in pair-end 250-bp long reads mode according to manufacturer's protocols. Analysis was performed as described earlier (39). To compare pattern of spacer choice specificity between different experiments, the Pearson coefficient, which is a measure of the linear dependence between two variables was used. A Pearson coefficient of 1 indicates total positive linear correlation, 0—no linear correlation and −1—total negative linear correlation.Primer extension analysisOligonucleotides HS1 for pr/ext, HS1 rev pr/ext, HS2 for pr/ext or HS2 rev pr/ext were radiolabeled with γ-32PATP at the 5΄ end with T4 PNK. Extension reactions (10 μl) were performed with 200 ng of total DNA as a template using 40 thermal cycles of 15 s at 95°C, 30 s at 50°C and 30 s at 72°C. The reactions contained 1 pmol of labeled primer, 0.2 mM dNTP, 1 μl of 10× buffer, 5 units of Taq polymerase. As a marker, sequencing reactions with the same primer were set up on the purified pG8mut plasmid as template using the Thermo Sequenase Cycle Sequencing Kit (Affymetrix) following the manufacturer's instructions. The products were separated by denaturing (urea) 6% polyacrylamide gel and visualized using a Phosphorimager.Generation of model substrates20 pmol of oligonucleotides HS1_full/cmp for and HS1_full/cmp rev (or HS1_part/cmp for and HS1_part/cmp rev) were subjected to annealing (5 min at 95°C followed by slow temperature reduction in 1× annealing buffer (20 mM Tris–HCl (pH 7.5), 50 mM NaCl, 20 mM MgCl2) in 100 μl reactions. The annealed substrate was precipitated with glycogen (ThermoScientific) and used in downstream experiments. 210-bp long model substrate was prepared by PCR with appropriate primer pairs using pG8mut plasmid as a template for amplification. PCR-products were purified with GeneJET PCR Purification Kit (ThermoScientific). 1 pmole of model fragments was used to S1 or TaiI/FaiI treatment.

Article TitleSpacer-length DNA intermediates are associated with Cas1 in cells undergoing primed CRISPR adaptation

Abstract

During primed CRISPR adaptation spacers are preferentially selected from DNA recognized by CRISPR interference machinery, which in the case of Type I CRISPR–Cas systems consists of CRISPR RNA (crRNA) bound effector Cascade complex that locates complementary targets, and Cas3 executor nuclease/helicase. A complex of Cas1 and Cas2 proteins is capable of inserting new spacers in the CRISPR array. Here, we show that inEscherichia colicells undergoing primed adaptation, spacer-sized fragments of foreign DNA are associated with Cas1. Based on sensitivity to digestion with nucleases, the associated DNA is not in a standard double-stranded state. Spacer-sized fragments are cut from one strand of foreign DNA in Cas1- and Cas3-dependent manner. These fragments are generated from much longer S1-nuclease sensitive fragments of foreign DNA that require Cas3 for their production. We propose that in the course of CRISPR interference Cas3 generates fragments of foreign DNA that are recognized by the Cas1–Cas2 adaptation complex, which excises spacer-sized fragments and channels them for insertion into CRISPR array.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.