Materials and Methods

Chromosomal Targeting by the Type III-A CRISPR-Cas System Can Reshape Genomes inStaphylococcus aureus

MATERIALS AND METHODSBacterial strains, plasmids, and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 4. Escherichia coli was grown (220 rpm) in lysogeny broth medium (Franklin Lakes) or on lysogeny broth agar (LA) at 37°C. Staphylococcus aureus strains were grown (220 rpm) in tryptic soy broth (TSB) (Difco) or on tryptic soy agar plates (Difco) at 37°C. When needed, 150 μg/ml ampicillin sodium salt or 50 μg/ml kanamycin sulfate for E. coli or 15 μg/ml chloromycetin for S. aureus strains was added to the bacterial cultures.TABLE 4 Bacterial strains and plasmids used in this studyStrain or plasmid(s)CharacteristicsaSource or referencebStrains    E. coli TransT1Clone host strain; F− φ80(lacZ) ΔM15 ΔlacX74 hsdR (rK − mK+) ΔrecA1398 endA1 tonA TransGen    S. aureus        RN42208325-4; restriction-negative strainNARSA        AH1CA-MRSA; SCCmec type VHospital        Δcas6AH1; cas6-deleted strainPlasmids    pLI50Shuttle vector; Ampr Chlr46    pLIC-404pLI50 derivative with 404 bp of leader sequence and native CRISPR locus from S. aureus strain AH1This study    pLIC-252pLI50 derivative with 252 bp of leader sequence and native CRISPR locus from S. aureus strain AH1This study    pLIC-158pLI50 derivative with 158 bp of leader sequence and a native CRISPR array from S. aureus strain AH1This study    pLI-252pLI50 derivative with 252 bp of leader sequence and an artificial CRISPR array targeting mecAThis study    pLI-CpLI50 derivative with an artificial CRISPR array targeting the coding strand of mecAThis study    pLI-TpLI50 derivative with an artificial CRISPR array targeting the template strand of mecAThis study    pLI-1pLI50 derivative with an artificial CRISPR array containing one spacer targeting mecAThis study    pLI-11pLI50 derivative with artificial CRISPR arrays containing two identical spacers targeting mecAThis study    pLI-12pLI50 derivative with artificial CRISPR arrays containing two different spacers targeting mecAThis study    pLI-S17, pLI-S20,  pLI-S21,pLI-S22,   pLI-S23, pLI-S25,   pLI-S33, pLI-S36,   pLI-S39, pLI-S42,  pLI-S45LI50 derivative containing mecA-targeting spacers with the spacer length of 17, 20, 21, 22, 23, 25, 33, 36, 39, 42, or 45 ntThis study    pLI-M1, pLI-M2,  pLI-M3, pLI-M4,   pLI-M5, pLI-M6,   pLI-M7pLI-S36 derivative with different mutations in the first repeat sequenceThis study    pEASY blunt simpleCommercial cloning vector; Ampr KanrTransGenOpen in a separate windowaCA-MRSA, community-associated MRSA; Ampr, ampicillin resistant; Chlr, chloramphenicol resistant; Kanr, kanamycin resistant.bNARSA, Network on Antimicrobial Resistance in Staphylococcus aureus.Construction of artificial CRISPR arrays. To construct CRISPR plasmids that can be used further for cloning and expression of any spacer and repeat sequence, 404, 252, or 158 bp of the native CRISPR leader and CRISPR arrays were amplified with forward primers leader404-f (f stands for forward), leader252-f, or leader158-f and the reverse primer CRISPR-r (r stands for reverse). The products were then digested with KpnI and SacI and ligated to pLI50 previously digested with the same enzymes, generating plasmids pLIC-404, pLIC-252, and pLIC-158. These plasmids were then digested with ClaI and ligated with engineered spacer repeat units, yielding artificial CRISPR plasmids pLI-252 and pLI-158. The repeat and target-specific spacer regions were amplified by PCR with the primer pairs that contained engineered spacer repeat units. The repeats were digested with the enzyme Cla, which resulted in the introduction of subsequent spacer repeat units, and this procedure could be performed to construct any artificial CRISPR array. These plasmids were first introduced into S. aureus strain RN4220 for modification and subsequently transformed into S. aureus strain AH1 and its mutant strains. All plasmids extracted from S. aureus strain RN4220 were sequenced to confirm that no mutation occurred during the modification process. The sequences of the primers used in plasmid construction are shown in Table 5.TABLE 5 Primers used in this studyPrimerSequence (5′–3′)aApplicationLeader404-fCGGggtaccCATCTCAATTAAGCAGCTAAmplification for 404-bp leaderLeader252-fCGGggtaccCACCTAACTCACTATCAATAmplification for 252-bp leaderLeader158-fCGGggtaccCGTATTAAATGTAGTATACTAmplification for 158-bp leaderCRISPR-rCCGgagctcCCATCCCCTAAAAATTAATCCAmplification for a native CRISPR arrayCRISPR-Cas-f1TAACTCACTATCAATCATTTCTCCACAmplification for CRISPR-Cas locusCRISPR-Cas-r1GCATAATCCATCATCATTAATATCTATGAmplification for CRISPR-Cas locusCRISPR-Cas-f2TATAGAACTATTTGGCGTAATGAmplification for CRISPR-Cas locusCRISPR-Cas-r2GTAATCTTGCTTCTTCATAACTAmplification for CRISPR-Cas locusCRISPR-Cas-f3TTTATGGTTGGAGGTATAAGTATGACAmplification for CRISPR-Cas locusCRISPR-Cas-r3TATATTATACTATATTTCCCCATGCCAmplification for CRISPR-Cas locusR1-S1-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-1, pLI-11, pLI-12S1-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCCTGATTCAGGTTACGGACAAGGTGAAATACTGATTpLI-1,pLI-11, pLI-12R2-S2-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACCAATATGTATGCTTTGGTCTTTCTGCATTCCTGGApLI-12S2-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCTCCAGGAATGCAGAAAGACCAAAGCATACATATTGpLI-12R1-mecAC-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACGCAGTACCGGATTTGCCAATTAAGTTTGCATAApLI-CmecAC-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCpLI-CR1-mecAT-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACTTATGCAAACTTAATTGGCAAATCCGGTACTGCpLI-TmecAT-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCGCAGTACCGGATTTGCCAATTAAGTTTGCATAApLI-TR1-S17-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACATTTCACCTTGTCCGTApLI-S17S17-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCTACGGACAAGGTGAAATpLI-S17R1-S20-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACATTTCACCTTGTCCGTAACCpLI-S20S20-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCGGTTACGGACAAGGTGAAATpLI-S20R1-S21-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACATTTCACCTTGTCCGTAACCTpLI-S21S21-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCAGGTTACGGACAAGGTGAAATpLI-S21R1-S22-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACATTTCACCTTGTCCGTAACCTGpLI-S22S22-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCCAGGTTACGGACAAGGTGAAATpLI-S22R1-S23-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACATTTCACCTTGTCCGTAACCTGApLI-S23S23-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCTCAGGTTACGGACAAGGTGAAATpLI-S23R1-S25-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACATTTCACCTTGTCCGTAACCTGAATpLI-S25S25-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCATTCAGGTTACGGACAAGGTGAAATpLI-S25R1-S33-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACTAATCAGTATTTCACCTTGTCCGTAACCTGAATpLI-S33S33-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCATTCAGGTTACGGACAAGGTGAAATACTGATTApLI-S33R1-S36-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-S36S36-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCCTGATTCAGGTTACGGACAAGGTGAAATACTGATTApLI-S36R1-S39-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTApLI-S39S39-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTApLI-S39R1-S42-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATApLI-S42S42-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTApLI-S42R1-S45-fGATCGATAACTACCCCGAAGAATAGGGGACGAGAACTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATAATApLI-S45S45-R2-rCACTCTGTCCCCTATTCTTCGGGGTAGTTATCGATCTATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTApLI-S45R1-S36m1-fGATCGATAACTACCCCGAAGAATAGGGGACGACAACTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-M1R1-S36m2-fGATCGATAACTACCCCGAAGAATAGGGGACGAGGACTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-M2R1-S36m3-fGATCGATAACTACCCCGAAGAATAGGGGACGAGGGCTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-M3R1-S36m4-fGATCGATAACTACCCCGAAGAATAGGGGACGAGTTCTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-M4R1-S36m5-fGATCGATAACTACCCCGAAGAATAGGGGACGACGGTTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-M5R1-S36m6-fGATCGATAACTACCCCGAAGAATAGGGGACGTGGACTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-M6R1-S36m7-fGATCGATAACTACCCCGAAGAATAGGGGTACAGAACTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGpLI-M7mecA-fTAATAGTTGTAGTTGTCGGGTTTGGmecA detectionmecA-rCATCGTTACGGATTGCTTCACTGTTmecA detectioncas6-fTTTAGGAAGTATTTTACATGGCGTGcas6 detectioncas6-rCCAGAAAATTCACCAAACTTCAATAcas6 detectionCRISPR-RT-fGGGACGAGAACTTCAAATqRT-PCRCRISPR-RT-rCAGTATGAAACAAATCAAGGTqRT-PCRmecA-r-biotinATTCAGGTTACGGACAAGGTGAAATACTGATTANorthern blottingOpen in a separate windowaNucleotides in the restriction sites are indicated by lowercase letters.Preparation of electrocompetent S. aureus cells. S. aureus cells from 15% glycerol stock were streaked on a TSB agar plate and incubated at 37°C. A single colony was selected and incubated in 5 ml TSB at 37°C overnight. One-milliliter portions of the overnight culture were added to 100 ml TSB in a 500-ml flask and shaken at 37°C until an optical density at 600 nm (OD600) of 0.4 was reached. The culture was put on ice for 5 min and then transferred to a sterile, round-bottom centrifuge tube. The cells were collected by centrifugation at 2,500 ×  g at 4°C for 10 min, and the supernatant was discarded. The cells were gently resuspended in 10 ml of ice-cold 0.5 M sucrose, and the suspension was kept on ice for 5 min. The centrifugation and resuspension steps were repeated twice. The cells were then resuspended in 1 ml of ice-cold 0.5 M sucrose, and the suspension was kept on ice for 15 min. Finally, 100-μl aliquots were prepared in sterile microcentrifuge tubes and frozen in liquid nitrogen. The competent cells were stored at −80°C.Plasmid extraction and transformation in S. aureus. Plasmids from all S. aureus strains were isolated using a plasmid purification kit (Sangon Biotech) according to the manufacturer’s instructions, except that the cells were pretreated with digestion buffer containing 40 U/ml lysostaphin, 10 mg/ml lysozyme, and 10% (vol/vol) glycerol for 30 to 60 min. Plasmids were transformed into all S. aureus strains by electroporation. Plasmid DNA (100 to 500 ng) and electrocompetent S. aureus cells (100 μl) were mixed and placed in a Gene Pulser cuvette with a 0.2-cm electrode gap. The settings for electroporation are as follows: voltage, 2.5 kV; capacitor, 50 μF; resistance, 200 Ω. After electroporation, 400 μl TSB was immediately added to the cuvette, and the cuvette was put on ice for 15 min. The cells were then transferred into a 1.5-ml Eppendorf tube and incubated with shaking (220 rpm, 37°C) for 1 h before being spread on a TSB plate.Oxacillin susceptibility assay. The oxacillin susceptibility of the WT strain and transformants was evaluated by detecting the microbroth MIC of oxacillin according to Clinical and Laboratory Standards Institute (CLSI) criteria (43). The cultures of all strains were diluted to a final test concentration of approximately 5 × 104 CFU/well and incubated at 37°C for 24 h.Total RNA extraction and qRT-PCR. Total RNA was extracted by RNAiso plus according to the manufacturer’s instructions (TaKaRa). Residual DNA was digested with RNase-free DNase I (TaKaRa). Reverse transcription was carried out with the PrimeScript first-strand cDNA synthesis kit (TaKaRa), and real-time PCR was performed with SYBR Premix Ex Taq (TaKaRa) using a StepOne real-time system (Applied Biosystems). The quantity of cDNA was normalized to the abundance of pta cDNA (44). All the qRT-PCR assays were repeated at least three times.Evaluation of DNA targeting efficiency by real-time PCR. To analyze the ratio of mecA-positive clones in the S. aureus population, strains carrying mecA-targeting constructs were cultivated in TSB with chloromycetin (15 μg/ml) at 37°C for 24 h, then cells were collected, and genomic DNA was extracted. A final concentration of 200 ng/ml genomic DNA was used as the template. The real-time PCR was performed with SYBR Premix Ex Taq (TaKaRa) using the StepOne real-time PCR system (Applied Biosystems). The quantity of mecA measured by real-time PCR was normalized to the abundance of pta DNA (44). All the real-time PCR assays were repeated at least three times. The relative targeting activity of mecA-targeting spacer was equal to one minus the value of the relative quantity of mecA.Northern blot analysis. Total RNA (30 mg) was denatured at 95°C for 5 min and then separated with a 12% denatured polyacrylamide–7 M urea gel (100 V, 1.5 h) in 1× Tris-borate-EDTA (TBE) and transferred onto a nylon membrane in 0.5× TBE. The product was then immobilized by UV cross-linking and blotted with the biotin-labeled oligonucleotide probes. RNA-DNA hybridization detection using a North2South chemiluminescence hybridization and detection kit (Thermo Scientific) was performed to detect crRNAs.Determination of mature crRNA sequences by RACE. The 5′ and 3′ ends of crRNAs were determined by RACE using the full 3′ RACE core set version 2.0 and the full 5′ RACE kit (TaKaRa) as previously described (45). PrimeSTAR HS DNA polymerase (TaKaRa) was used for PCR amplification, and the amplified RACE products were ligated with pEASY-Blunt Simple Cloning vector (pEASY-Blunt Simple Cloning kit; TransGen Biotech). The ligation was transformed into E. coli TransT1, and transformants were characterized by colony PCR to amplify the RACE products. The positive colonies were sequenced using the M13 forward sequencing primer (Sangon Biotech).Genomic DNA extraction and sequencing. Genomic DNA was extracted and sequenced using an Illumina Hiseq 2000 platform (Institute of Microbiology, Chinese Academy of Sciences, Beijing, China). About 1.8 GB of high-quality sequence data of each genome was then mapped using SOAP (short oligonucleotide alignment program; BGI) software.Statistical analysis. First, F test for two samples was performed for variances. Unpaired two-tailed t test for equal or unequal variances was then performed to calculate the significant differences (P value). All the tests were performed by the data analysis tool in Microsoft Excel.

Article TitleChromosomal Targeting by the Type III-A CRISPR-Cas System Can Reshape Genomes inStaphylococcus aureus

Abstract

S. aureuscells from 15% glycerol stock were streaked on a TSB agar plate and incubated at 37°C. A single colony was selected and incubated in 5 ml TSB at 37°C overnight. One-milliliter portions of the overnight culture were added to 100 ml TSB in a 500-ml flask and shaken at 37°C until an optical density at 600 nm (OD600) of 0.4 was reached. The culture was put on ice for 5 min and then transferred to a sterile, round-bottom centrifuge tube. The cells were collected by centrifugation at 2,500 ×gat 4°C for 10 min, and the supernatant was discarded. The cells were gently resuspended in 10 ml of ice-cold 0.5 M sucrose, and the suspension was kept on ice for 5 min. The centrifugation and resuspension steps were repeated twice. The cells were then resuspended in 1 ml of ice-cold 0.5 M sucrose, and the suspension was kept on ice for 15 min. Finally, 100-μl aliquots were prepared in sterile microcentrifuge tubes and frozen in liquid nitrogen. The competent cells were stored at −80°C.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.