Materials and Methods

CRISPR/Cas9 in zebrafish: An attractive model for FBN1 genetic defects in humans

2. MATERIALS AND METHODS

2.1. Zebrafish care and husbandry

TU wild‐type zebrafish and transgenic Tg (cmlc2:eGFP) zebrafish possessing a green fluorescent heart (Siegert et al., 2018) were obtained from Model Animal Research Center of Nanjing University (Nanjing Jiangsu, China). Embryos were treated with 0.003% tyrosine inhibitor 1‐phenyl‐2‐thio‐urea (cat# P7629‐10G, Sigma‐Aldrich) to inhibit pigment formation. The fish were maintained at 26 ± 2℃ under a 14 hr light: 10 hr dark cycle in a zebrafish circulation breeding system (ESON; Beijing Aisheng Technology Development Co., Ltd.). To generate offspring, mating was carried out at a ratio of 1:1, followed by natural spawning.

2.2. Generation of Cas9 transgenic zebrafish

fbn1 gene has not been sequenced in many databases, this design is based on NCBI database (https://www.ncbi.nlm.nih.gov/gene/XM_017351990.2). fbn1 sgRNAs (CRISPR1: TGCGGAAGAGCTTGTGCTACAGG; CRISPR2: TCCGACAACGCCACATGTGACGG; CRISPR3: CCAGGCGCGGCCGATGTTGTAGG; CRISPR4: GGGAACGGGACACTTCTCGCAGG) were designed and synthesized by Nanjing YSY Biotech Company. The target sequences are in exon 16, near to the 1731st amino acid. A mixture (1 nl) of each sgRNA (80–100 ng/µl) and Cas9 protein (200 ng/µl; cat# P‐020, Nanjing YSY Biotech) was injected into embryos (F0). The F0 embryos injected with Cas9/sgRNA were raised to sexual maturity, and four pairs of female and male zebrafish were mated to obtain F1 embryos.

2.3. Genotyping of transgenic zebrafish

Genomic DNA was obtained from F1 embryos at 24 hr post‐fertilization (hpf) for genotyping using the forward (5′‐GAATCCTGGCATCTGTGGTC‐3′) and reverse (5′‐TTGCGCAAATCTTCTACTCAAA‐3′) primers. The PCR protocol was 95℃ for 3 min, 30 cycles of 95℃ for 30 s, 62℃ for 30 s and 72℃ for 1 min, and 72℃ for 10 min. PCR products were sequenced to identify the mutation. F0 with heritable mutations were selected to mate to generate F1 offspring, followed by genomic DNA collection at 2 months post‐fertilization for genotyping. PCR reaction was performed using the primers and PCR protocol mentioned above, followed by sequencing. To confirm the genotype carried by the mutants, the PCR products of mutant 1 and mutant 2 carrying the fbn1 frameshift mutation were recombined into the pGEM‐T Easy vector. After transformation, a single colony was selected for PCR identification. The confirmed F1 fbn1 +/− heterozygotes were used in the following investigation.

2.4. Morphology assessment

The F1 adult fbn1 +/− zebrafish were mated with Tg(cmlc2:eGFP) fish to generate F2 transgenics. The morphology of F2 embryos/larvae and TU control group were examined at 72 hpf, 120 hpf, 12 dpf, 19 dpf, 26 dpf, 33 dpf, and 40 dpf using a stereomicroscope (MC50‐S; Mingmei). Images were acquired using an SZX7 camera (Olympus). The initial sample size was 310 in F2 fbn1+/− zebrafish experimental group and TU control group, respectively. The death rate was about 3%. The abnormal phenotypes of the F2 and TU groups were analyzed statistically. The experiment was repeated three times.

2.5. All reagents used in the experiment include the following

YSY buffer (cat# R‐001, Nanjing YSY Biotech), Zebrafish genotyping kit (cat# K‐101, Nanjing YSY Biotech), 2‐Mastermix (cat# P111‐01, Vazyme Biotech Co., Ltd), Ultrapure water without ribozyme pollution (cat# R‐002, Nanjing YSY Biotech), 1‐phenyl‐2‐thiourea (cat# P7629‐10G, Sigma‐Aldrich), T7 in vitro Transcription Kit (cat# P7629‐10G, TaKaRa), MAXIscript SP6/T7 (cat# AM1314, Ambion), PCR clean up Kit (cat# AP‐MN‐P‐250, Axygen), DL5000 marker (cat#3428A, TaKaRa), Ampicillin (cat# A610028, Sangon Biotech Co., Ltd), DNase I (cat# 2238G2, Ambion), PCR‐related reagent T4 ligase (cat# M0202L, New England Biolabs), PGEM‐Teasy Vector (cat# A1360, Nanjing YSY Biotech), Cas9 protein (cat# P‐020, Nanjing YSY Biotech), Conventional chemical reagent (cat# 10010360, cat# 30148126, cat# 71001453, Shanghai Chemical Reagent, Co., Ltd; cat#34943‐6X1L, cat#296821‐1L, cat# 284505‐2L, Sigma Aldrich).

2.6. Ethical Compliance and Ethical Considerations

The animal protocol was approved by an ethics committee of the Institutional Animal Care and Use Committee of The 1st Medical Center of Chinese PLA General Hospital (Beijing, China). All animal experiments were performed following the guidelines for animal welfare in Laboratory of Translational Medicine of The 1st Medical Center of Chinese PLA General Hospital.

Article TitleCRISPR/Cas9 in zebrafish: An attractive model for FBN1 genetic defects in humans

Abstract

Mutations in the fibrillin‐1 gene (FBN1) are associated with various heritable connective tissue disorders (HCTD). The most studied HCTD is Marfan syndrome. Ninety percent of Marfan syndrome is caused by mutations in the FBN1 gene. The zebrafish share high genetic similarity to humans, representing an ideal model for genetic research of human diseases. This study aimed to generate and characterize fbn1 +/− mutant zebrafish using the CRISPR/Cas9 gene‐editing technology.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.