Materials and Methods

Inhibition of long non-coding RNA UCA1 by CRISPR/Cas9 attenuated malignant phenotypes of bladder cancer

MATERIALS AND METHODSIn vitro experimentsPlasmidsThe hCas9 expression vector (plasmid 44758) and gRNA cloning vectors (plasmid 41824) were obtained from Addgene (Cambridge, MA, USA). The plasmids were prepared by using the Qiagen Endofree Plasmid Kit (Qiagen, Hilden, Germany).Design and cloning of UCA1-specific gRNAgRNA expression plasmids were constructed according to manufacturer's protocol 46 and detailed BLAST searches of the human and murine genomes were conducted to identify potential off-target binding of UCA1 gRNAs. To assess the utility of UCA1-targeting gRNAs, 8 sets of oligonucleotides (Table ​(Table2)2) were designed to target the complete genomic UCA1. All oligonucleotides were synthesized and purified by Sangon Biotech Co (Shanghai, China). Briefly, to prepare a 100-bp double-stranded DNA insert fragment containing the target sequence (20 bp) and a protospacer-adjacent motif sequence, we used a set of oligonucleotides and generated the fragment using T4 PNK (NEB, Ipswich, MA, USA). The double-stranded DNA fragment was purified and inserted into the BbsI site of a gRNA cloning vector with T4 DNA ligase (NEB, Ipswich, MA, USA).Table 2The sequences and location of gRNANameGenomic targetTarget locationUCA1-1CACCGTGGATCTCTTCACGGAATGCACCTAGAGAAGTGCCTTACCAAA89-109UCA1-2CACCGTCTGAAAAGAGAGTCAGCGACAGACTTTTCTCTCAGTCGCTCAAA114-134UCA1-3CACCGTGTGCTATAAATGACCGGGTCACACGATATTTACTGGCCCACAAA189-209UCA1-4CACCGGGGGACTCCTTCGTGAGACCCCCCTGAGGAAGCACTCTGCAAA201-221UCA1-5CACCGCTTCGGGTAACTCTTACGGCGAAGCCCATTGAGAATGCCCAAA265-285UCA1-6CACCGCGTAAGAGTTACCCGAAGCTCGCATTCTCAATGGGCTTCGACAAA289-309UCA1-7CACCGTGCTATAAATGACCGGGTACACGATATTTACTGGCCCATCAAA356-376UCA1-8CACCGAGGGGCAGCTTTATAGGGCTCTCCCCGTCGAAATATCCCGACAAA24-44Open in a separate windowCell culture and transfection5637 and T24 bladder cancer cell lines were obtained from Chinese Type Culture Collection of Chinese Academy of Sciences, maintained in our laboratory and routinely cultured in RPMI 1640 medium (Invitrogen), supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere containing 5% CO2. All experiments were performed using the log phase cells.The 5637 cells and T24 cells were seeded in 6-well plates 24 h prior to transfection. Polyethylenimine was used to transfect cells with 1μg of the hCas9 expression vector and 1μg of the gRNA expression vector. The control group was transfected with no vector, and the gRNA-empty vector group was transfected with 1μg of hCas9 expression vector and 1μg of gRNA-empty vector using Lipofectamine2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.T7 endonuclease 1 assayTo confirm that DNA cleavage and targeted sequence disruption occurred at the intended site, a mismatch-sensitive T7 endonuclease 1 assay (NEBIpswich, MA, USA) was performed. The DNA region encompassing the S- and X-target site was amplified under standard conditions using the following primers: S1 forward: 5′-CCTTAACTAATTAACCCACC-3′and reverse: 5′-AAGAGAGTCAGCGAAGGGAG-3′. The PCR products were subjected to heteroduplex formation after denaturing 200 ng of amplified DNA at 95°C for 5 min followed by slow cooling to 35°C. The samples were treated with 5 U of T7 endonuclease 1 in 1 × NEB Buffer 2, incubated at 37°C for 30 min and then analyzed by agarose gel electrophoresis. Tanon electrophoretical software (Tanon Science & Technology Co., Ltd., Shanghai, China) was used to measure band intensities, and the targeted disruption was observed according to the previous description by Guschin et al 58.RNA isolation and quantitative RT-PCRTotal RNA was extracted from bladder cell lines using TRIzol reagent (Invitrogen Carlsbad, CA, USA) according to the manufacturer's instructions. The expression levels of UCA1 were determined by quantitative RT-PCR using a SYBR Premix Ex Tap II kit (Takara, Dalian, China) on a CFX96 real-time PCR System (Bio-Rad, Hercules, CA, USA), and the results were normalized using β-actin as an internal control.Cell proliferation assayThe MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma-Aldrich, MO, USA) colorimetric assay was used to validate the cell viability 59. 15,000 cells per well were seeded in 96-well plates on the day prior to transfection. Groups of replicates included cells that were untransfected, CRISPR+Cas9+gRNA empty vector transfected, or transfected with CRISPR+Cas9+UCA1 gRNA. Cell viability was assessed 3 days after transfection by adding 20 μl of MTT (5 mg/ml) to each well, and incubating at 37°C for 1 h. Metabolism of the MTT to form the blue formazan was determined by measuring the ratio of optical density at a wavelength of 570 nm, to the background at 690 nm.Apoptosis analysisCells were distributed on a 6-well plate at a density of 5 x 105 per well. After transfection for 48 h, cells were harvested and washed with PBS three times. Then the cell apoptosis was detected by Annexin V/FITC and propidium iodide (PI) binding assay according to the manufacturer's instructions (BD Biosciences, Franklin Lakes, NJ, USA). The mixed solution was gently shaken and stored away from light at room temperature for 15 min. The stained cells were analyzed directly by flow cytometry using Cell Quest software (BD Biosciences, Franklin Lakes, NJ, USA).Cell cycle analysisCells transfected with CRISPR/Cas9 vectors were washed with PBS and fixed with 75% ethanol overnight at -20°C. Cells were resuspended in PBS and treated with RNase for 30 min at room temperature. The cell nucleus was stained with propidium iodide (Sigma, Saint Louis, MO, USA) and incubated for 20 min in the dark. Cell cycle phases were determined by flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA) and analyzed with FlowJO 7.6 program.Wound healing assayCell migration assay was performed using 12-well plates as previously described 46. Cells were seeded into 12-well plates (1 x 105 cells/ml) and grown to 80-90% confluence for the experiment. Cells were scraped with 200 μl sterile pipette tip to create a scratch. They were washed twice with PBS to remove cellular debris and then replaced with complete 1640 medium. Cells were transfected with CRISPR/Cas9 and incubated for 48 h. Cell migration into the wound area was photographed at the timepoints of 0 h, 24h, 48 h, respectively, for the image analysis of each treatment. The wound healing level was determined using a Hewlett-Packard scanner and NIH Image software (Image J).Cell migration/invasion assayThe invasive behavior of 5637 and T24 cells was tested using cell invasion chamber kit (BD Bioscience, San Jose, CA, USA). Cells were re-suspended in a serum-free 1640 medium (5x104 cells/200 μl). Cells were seeded onto the upper chamber of Matrigel-coated filter, and 500 μl of RPMI 1640 medium containing 10% FBS was added in the lower chamber. After 48 h incubation, the non-invading cells were removed from the upper surface of the filter membrane. The migrated cells on the lower surface of the filter membrane were stained with crystal violet for 1 h and rinsed with PBS. The amount of invading cells on the lower surface of filter membrane was determined using a light microscope and NIH Image software (Image J).Gelatin zymographyMMP-2/9 activity was determined by gelatin zymography. Briefly, cells were seeded (1 x 105 cells/well) and allowed to grow to confluence for 24 h and maintained in 1640 medium with 10% FBS. The cells were washed with PBS and transfected with CRISPR/Cas9 systems for 48 h. The supernatant was then collected and mixed with loading buffer, then electrophoresed in 10 % polyacrylamide gel containing 0.1 % (w/v) gelatin. After the electrophoresis, gel was washed with washing buffer (2.5 % Triton X-100 in dd H2O) for 30 min and incubated at room temperature for additional 18 h for the enzymatic reaction of MMPs in zymography reaction buffer (200 mM NaCI, 10 mM CaCl2, 50 mM Tris-HCI, PH 7.4). The gel was then stained with Coomassie blue R-250(0.125% Coomassie blue R-250, 50% methanol, 10% acetic acid) for 1 h and destained with destaining solution (20 % methanol, 10 % acetic acid, 70 % dd H2O) until the clear bands were visualized.In vivo experimentsApproval for animal experiments was obtained from the institutional animal welfare committee. Pathogen-free male BALB/C nude mice (aged 4-5wk, SPF grade and weighing 18-20g) were purchased from the center of experimental animal, the Academy of Military Medical Science (Beijing, China). The nude mice were caged individually under specific-pathogen free (SPF) conditions. All animal experiments were performed strictly in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The mice were randomly assigned to the control or experimental group (six mice per group). 5637 cells transfected with gRNA empty vector or CRIPSR/Cas9-UCA1-(1+8) were harvested and injected subcutaneously into each mouse (2x106/0.2 ml). Tumor volume was estimated every three days by the formula: 0.5x length x width2. All mice were sacrificed after 33 days. Tumor tissues were excised, paraffin-embedded, formalin-fixed and H&E stained, and were further analyzed by western blot.Western blotTotal protein was extracted with RIPA buffer (50 mM Tris-HCl PH 7.5), 150nM NaCl, 1% Triton X-100, 0.5% Na-deoxycholatc) containing protease inhibitiors. 30 μg samples of the lysates were separated on 8%-12% SDS-PAGE gels and transferred to PVDF membranes. The membranes were incubated with primary antibodies including anti-human MMP2 and MMP9 (Abcam, Cambridge, MA, USA; 1:500), Bax and Bcl-2 (Cell Signaling Technology, Beverly, MA, USA; 1:500) overnight at 4°C followed by incubation with a HRP-conjugated secondary antibody. Finally, the blots were detected using ECL substrate.Clinical studyMeta analysis Study strategy This meta-analysis was conducted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) guidelines 60. A prespecified protocol that included the data sources, search strategy, inclusion/exclusion criteria for the articles, and analysis methods was developed before the beginning of this study.We followed the Cochrane Handbook for Systematic Reviews of Diagnostic Test Accuracy and the Meta-analysis Of Observational Studies in Epidemiology (MOOSE) 61. The identification of relevant studies was conducted in a search of the PubMed, MEDLINE, EMBASE and China National Knowledge Infrastructure (CNKI) databases for the period of Jan 2000 to Dec 2013. The search term was “UCA1”, “long intergenic noncoding RNA”, “noncoding RNA”, “lncRNA”, “lincRNA”, “bladder cancer”, “bladder carcinoma”, “bladder neoplasm”, “prognosis”, “prognostic” Clinical and pathologic variables were also dichotomized. For each variable, summary odds ratios and their 95% confidence intervals were estimated using the inverse variance weighted method. Because the meta-analysis involved expression data assessed by different methods, we used the random-effects model. Forest plots were used to present the results. The meta-analysis was conducted with the use of Meta-Disc 1.4 (Ramon y Cajal Hospital, Madrid, Spain).Study selection The same two investigators independently assessed all the eligible studies and extracted the data. Studies were considered eligible if they met the following criteria: any type of human bladder cancer was studied; UCA1 expression was determined in human urine using quantitative PCR; If data subsets were published in more than one article, only the most recent one was included. Citations were limited to those published in the English language. If the data could not be extracted or calculated from the original article, the study was excluded. Disagreements were resolved through discussion with Correspondence author.Inclusion and exclusion criteria The studies qualified to be included must have fulfilled the following criteria: (i) investigated the diagnostic potential of (urine) UCA1 for human bladder cancer, (ii) used the gold standard to confirm the diagnosis of cancer patients, and (iii) provided sufficient data. The studies are excluded if they (i) are obviously not related to our topic; (ii) are in forms of letters, editorials, case reports, or reviews; and (iii) used other types of samples other than urine.Data extraction and quality assessment Data from all eligible studies were extracted as follows: (i) basic characteristics of publications, including name of first author, year of publication, country of the study, ethnicity of subjects, number of participants, types of disease, and types of samples, and (ii) diagnostic results, including sensitivity, specificity, true positive, false positive, false negative, and true negative, respectively. Quality Assessment of Diagnostic Accuracy Studies 2 (QUADAS-2) was used to evaluate the quality of included publications.Statistical analysisThe SPSS 16.0 software system (SPSS, Chicago, IL, USA) was used for statistical analysis. Data are expressed as the mean+-standard error (SD). The differences between groups were analyzed using a Student t test when only 2 groups were compared or one-way analysis of variance when more than 2 groups were compared. Kaplan-Meier method and log-rank test were performed for patients’ survival analysis. All experiments were run in triplicate. P<0.05 was considered statistically significant, and P< 0.01 was considered highly significant.

Article TitleInhibition of long non-coding RNA UCA1 by CRISPR/Cas9 attenuated malignant phenotypes of bladder cancer

DOI
Published
2016 Dec
License

Abstract

CRISPR/Cas9 is a novel and effective genome editing technique, but its application is not widely expanded to manipulate long non-coding RNA (lncRNA) expression. The lncRNA urothelial carcinoma-associated 1 (UCA1) is upregulated in bladder cancer and promotes the progression of bladder cancer. Here, we design gRNAs specific to UCA1 and construct CRISPR/Cas9 systems targeting UCA1. Single CRISPR/Cas9-UCA1 can effectively inhibit UCA1 expression when transfected into 5637 and T24 bladder cancer cells, while the combined transfection of the two most effective CRISPR/Cas9-UCA1s can generate more satisfied inhibitory effect. CRISPR/Cas9-UCA1s attenuate UCA1 expression via targeted genome-specific DNA cleavage, resulting in the significant inhibition of cell proliferation, migration and invasionin vitroandin vivo. The mechanisms associated with the inhibitory effect of CRISPR/Cas9-UCA1 on malignant phenotypes of bladder cancer are attributed to the induction of cell cycle arrest at G1 phase, a substantial increase of apoptosis, and an enhanced activity of MMPs. Additionally, urinary UCA1 can be used as a non-invasive diagnostic marker for bladder cancer as revealed by a meta-analysis. Collectively, our data suggest that CRISPR/Cas9 technique can be used to down-modulate lncRNA expression, and urinary UCA1 may be used as a non-invasive marker for diagnosis of bladder cancer.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.