Materials and Methods

Development of a CRISPR/Cas9 System forMethylococcus capsulatusIn VivoGene Editing

MATERIALS AND METHODSBacterial strains and cultivation conditions. The strains used in this study are described in Table 1. Methylococcus capsulatus (Bath) was cultured on modified nitrate mineral salts (NMS) agar supplemented with 5 µM CuSO4 (the formulation is shown in Table S1 in the supplemental material), unless otherwise indicated, at 37°C inside stainless-steel gas chambers (Schuett-biotec GmbH) containing 20% (vol/vol) methane in air (42). The NMS agar was supplemented with 100 µg/ml kanamycin, 100 µg/ml spectinomycin, and/or 30 µg/ml gentamicin for selection and cultivation of the respective M. capsulatus strains. E. coli strains were cultured on lysogeny broth (LB) agar or in LB liquid medium at 37°C at 200 rpm. LB liquid medium was supplemented with 50 µg/ml kanamycin, 50 µg/ml spectinomycin, 10 µg/ml gentamicin, and/or 100 µg/ml ampicillin for selection and cultivation of the respective E. coli strains. Broad-host-range plasmids were transferred to M. capsulatus via biparental mating using E. coli S17-1 cells on NMS mating agar (the formulation is shown in Table S1), as described previously (25). Prior to conjugation, M. capsulatus biomass harboring pCas9 or pCas9D10A was spread on NMS mating medium supplemented with 500 ng/ml aTc and incubated at 37°C inside stainless-steel gas chambers (Schuett-biotec GmbH) containing 20% (vol/vol) methane (99.97% purity) in air for 24 h. A schematic of the experimental design for using the CRISPR/Cas9 system in M. capsulatus is shown in Fig. 2C.TABLE 1Strains and plasmidsNameGenotype or descriptionSourceStrains Methylococcus capsulatus BathWild typeATCC 33009 E. coli Zymo 10BF− mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara leu) 7697 galU galK rpsL nupG λ−Zymo Research E. coli S17-1Tpr Smr recA thi pro hsd(r− m+)RP4-2-Tc::Mu::Km Tn7ATCC 47055Plasmids    pCAH01PtetA bla tetR CoE1 ori F1 oriV oriT trfA ahp21    pCAH01SpRahp CDS exchanged with aadA CDSThis study    pCAH01::GFPGFP cloned downstream of PtetA21    pCAH01SpR::Cas9Cas9 cloned downstream of PtetAThis study    pAWP78Source of ahp locus used to generate pQCH25    RSF1010oriV oriT mobABC repABC sul2 strAB44    pQCHRSF1010Δ7.626-2.200 kb ahpThis study    pQCH::GFPpQCH with promoterless superfolder GFPThis study    pQCH::PmmoX-GFPPmmoX cloned upstream of GFP in pQCH::GFPThis study    pQCH::Pmxa-GFPPmxa cloned upstream of GFP in pQCH::GFPThis study    pQCH::PpmoC1-GFPPpmoC1 cloned upstream of GFP in pQCH::GFPThis study    pQCH::PpmoC2-GFPPpmoC2 cloned upstream of GFP in pQCH::GFPThis study    pQCH::PpmoC1-BFPPpmoC1-BFP cloned from PpmoC1-GFPThis study    pBBR1MCS-5pBBR oriT aacC145    pBBR1-GFPPmxa-gRNA-GFP cloned into pBBR1This study    pBBR1-GFPBFPPmxa-gRNA-GFPBFP cloned into pBBR1This study    pBBR1-mmoXPmxa-gRNA-mmoX cloned into pBBR1This study    pBBR1-mmoXTAAPmxa-gRNA-mmoXTAA cloned into pBBR1This studyOpen in a separate windowTo evaluate promoter activity, M. capsulatus harboring GFP reporter plasmids was spread onto NMS agar supplemented with 0 µM or 5 µM CuSO4. GFP expression from the tetracycline promoter/operator (PtetA) in pCAH01 was induced by plating on NMS agar supplemented with 500 ng/ml aTc. Strains were incubated at 37°C inside stainless-steel gas chambers (Schuett-biotec GmbH) in 20% (vol/vol) methane in air for 72 h, and the GFP fluorescence intensity was quantified as described below. Promoter activity was determined in E. coli subcultured 1/100 in LB liquid medium and incubated for ∼3 h to an optical density at 600 nm (OD600) of 0.5 at 37°C at 200 rpm. A 200-µl volume of E. coli cell suspension was transferred to a 96-well plate for quantification of the GFP fluorescence intensity as described below.Cloning and genetic manipulation. The plasmids used in this study are described in Table 1. The primers and synthetic DNA fragments used in this study were synthesized by Integrated DNA Technologies, Inc. (IDT), and are described in Table 2 and Table S2 in the supplemental material, respectively. Plasmids and DNA inserts were amplified using Q5 High-Fidelity 2× Master Mix (NEB), assembled using Gibson NEBuilder HiFi DNA assembly (New England Biolabs), and transformed into Mix and Go competent E. coli strain Zymo 10B (Zymo Research), according to the manufacturers’ instructions. Genetic constructs were verified by Sanger sequencing (Genewiz). The Cas9 open reading frame was amplified, using primers TT16 and CAH537 (Table 2), from Addgene plasmid no. 42876 (29) and cloned into pCAH01SpR via Gibson assembly. The Cas9D10A nickase variant was generated by site-directed mutagenesis with primers TT143 and TT144 (Table 2) using the QuikChange primer design program and protocol (Agilent). Single gRNAs containing a 20-mer adjacent to the PAM site on the target DNA and editing cassettes were synthesized by IDT (see Table S2) and cloned into the pBBR1MCS-5 vector via Gibson assembly. pQCH was constructed by replacing a 3,312-bp region of RSF1010 containing the sulfR, smrA, and smrB genes with the kan2 locus from pAWP78 (25). To evaluate promoter activity, native M. capsulatus promoters were cloned upstream of the superfolder green fluorescent protein-encoding gene (26) into pQCH.TABLE 2PrimersPurposePrimer namea Sequenceb Insert aadA into pCAH01CAH520 aadA FcagtgttacaaccaattaaccaattctgatTTATTTGCCGACTACCTTGCAH521 aadA RcttacataaacagtaatacaaggggtgttaATGGCTTGTTATGACTGTTTTTTTGCAH522 pCAH01 FTAACACCCCTTGTATTACTGCAH519 pCAH01 RATCAGAATTGGTTAATTGGTTGClone Cas9 into pCAH01TT16 Cas9 FcactccctatcagtgatagagaaaagtgaaATGGATAAGAAATACTCAATAGGCCAH537 Cas9 RcttcacaggtcaagcttTTTTAGGAGGCAAAAATGGATAAGCAH152 pCAH01 FAAGCTTGACCTGTGAAGTGCAH149 pCAH01 RTTCACTTTTCTCTATCACTGATAGConstruct Cas9D10ATT143 Cas9D10A FGAAATACTCAATAGGCTTAGCCATCGGCACAAATAGCGTCGTT144 Cas9D10A RCGACGCTATTTGTGCCGATGGCTAAGCCTATTGAGTATTTCConstruct pQCHCAH1032 ahp FttatattcaatggcttatttGCTCGGGACGCACGGCGCCAH1033 ahp RcggaacatgcctcatgtggcGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATCAH1034 RSF1010 FGCCACATGAGGCATGTTCCGCAH1031 RSF1010 RAAATAAGCCATTGAATATAAAAGATAAAAATGTCConstruct pQCH::GFPCAH1044 pQCH FCATACAGTCTATCGCTTAGCGCAH1037 pQCH RTATTGCAAGGACGCGGAACCAH1045 GFP FATGAGCAAAGGAGAAGAACAmplify pQCH::GFP partsCAH1040 GFP FgaggaaacaagtaATGAGCAAAGGAGAAGAACCAH1041 GFP RttatttgatgcctTTATTTGTAGAGCTCATCCCAH1042 rrnBT1T2 FgctctacaaataaAGGCATCAAATAAAACGAAAGGCCAH1043 rrnBT1T2 RtttccgctaagcgatagactgtatgCATCCGTCAGGATGGCCTTCClone promoters into pQCH::GFPCAH1046 Pmxa FaggcatgttccgcgtccttgcaataGAGGTTCAGGCGAAACCGCAH1047 Pmxa RctcctttgctcatGTGTCTCCTCCAAGAATGATTGCAH1048 PpmoC1 FaggcatgttccgcgtccttgcaataAACGTCACGATGGGTGTTCCAH1049 PpmoC1 RctcctttgctcatTGTTTGTTCCTCCTAAAGTGATGCAH1050 PpmoC2 FaggcatgttccgcgtccttgcaataCCCTCGTGTCCGGCGTACCAH1051 PpmoC2 RctcctttgctcatTTTTACCTCCAACTGTTATATCGATGTGAACACCAH1038 PmmoX FaggcatgttccgcgtccttgcaataTCCGCAGTGGTCGGATCGCAH1039 PmmoX RctcctttgctcatTACTTGTTTCCTCCGTAACACATTCTATGConstruct pgRNA-GFP and pgRNA-mmoXTT254 Pmxa gRNA FtccaattcgccctatagtgaGAGGTTCAGGCGAAACCGTT272 gRNA only RgcaatagacataagcggctaGGATCAGATCACGCATCTTCTT256 pBBR1 FTAGCCGCTTATGTCTATTGCTGTT253 pBBR1 RTCACTATAGGGCGAATTGGAGConstruct GFPBFP editing templateTT207 GFP FatctgatccttcggaccgacggattGGACCGACGGATTTTATGTT208 BFP RcattgaaccccatggcTCAGAGTAGTGACAAGTGTTGTT209 BFP FctactctgagccatgggGTTCAATGCTTTTCCCGTTTT255 GFP RgcaatagacataagcggctaTGCCATGTGTAATCCCAGCheck GFP/BFP editing locusTT288 GFP check FTCCGCGTCCTTGCAATAAACTT289 GFP check RCCGCTAAGCGATAGACTGTATGTT271 GFP seq RGTACATAACCTTCGGGCATGCheck mmoX editing locusTT290 mmoX check FCCAGTACGTCACCGTTATGTT291 mmoX check RAGATCTTGCCGTAGTGGTCTT292 mmox seq FCTGGAAGTGGGCGAATACOpen in a separate windowaF, forward; R, reverse.bLowercase indicates homologous sequence for Gibson assembly.GFP and BFP expression quantification. To evaluate Cas9- and Cas9D10A-mediated plasmid editing, fluorescence intensity was measured in a Fluostar Omega microplate reader (BMG Labtech) at an excitation wavelength (λex) of 485 nm and an emission wavelength (λem) of 520 nm (GFP) or a λex of 355 nm and a λem of 460 nm (BFP). For GFP-to-BFP gene-editing experiments, the data represent relative fluorescence units (RFU) of the measured BFP intensity relative to pQCH::PpmoC1-GFP control intensity normalized to the cell density.Verification of mutations by colony PCR and HpaI digestion. To evaluate Cas9- and Cas9D10A-mediated genomic editing of the mmoX locus, colony PCR was performed with primers TT290 and TT291 (Table 2) using Taq 2× Master Mix (NEB) according to the manufacturer’s instructions. The PCR mixture was used directly as the template for HpaI endonuclease (NEB) digestion, and the edited strains were identified by positive DNA digestion visualized by DNA electrophoresis. Targeted editing of the mmoX locus in positive transformants was verified by sequence analysis.Colorimetric sMMO assay. M. capsulatus sMMO activity was tested with a colorimetric assay as previously described (43). Briefly, ∼1e6 cells were spotted onto NMS agar with or without 5 µM CuSO4 and cultured at 37°C. After 96 h of growth, ∼300 to 400 mg naphthalene (Sigma-Aldrich) crystals was placed into the petri dish lid and incubated with the bacteria for 1 h at 37°C to allow conversion of naphthalene to naphthol. After incubation, 20 µl of freshly prepared 5-mg/ml o-dianisidine (Sigma-Aldrich), which turns purple in the presence of naphthol, was added directly to the M. capsulatus biomass. Color development was allowed to occur for 15 min at 37°C.Statistical analysis. Statistical analysis of data was performed and graphical representations were created using GraphPad Prism 6.0 software. Determination of statistical significance between two comparisons was achieved using an unpaired t test. Determination of statistical significance between multiple comparisons was achieved using a one-way analysis of variance (ANOVA) followed by Dunnett’s test with the appropriate controls. Normal distribution and equal variance between test groups were assumed prior to performing statistical tests using Prism software.

Article TitleDevelopment of a CRISPR/Cas9 System forMethylococcus capsulatusIn VivoGene Editing

Abstract

To evaluate Cas9- and Cas9D10A-mediated plasmid editing, fluorescence intensity was measured in a Fluostar Omega microplate reader (BMG Labtech) at an excitation wavelength (λex) of 485 nm and an emission wavelength (λem) of 520 nm (GFP) or a λexof 355 nm and a λemof 460 nm (BFP). For GFP-to-BFP gene-editing experiments, the data represent relative fluorescence units (RFU) of the measured BFP intensity relative to pQCH::PpmoC1-GFP control intensity normalized to the cell density.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.