Materials and Methods

Cooperation between Different CRISPR-Cas Types Enables Adaptation in an RNA-Targeting System

Bacterial cultures and sampling.

Two strains were used to test for CRISPR spacer acquisition: Flavobacterium columnare B185 and B245 (34). Strain B185 was used as the host in the main spacer acquisition assays, and strain B245 was used in the cas1 deletion mutant experiments. Strain B185 was revived from a freezer stock in a Shieh medium culture grown overnight (72). Five replicates of 5-ml cultures were then inoculated in 0.1× Shieh medium with the culture grown overnight to produce an initial concentration of 104 CFU/ml. Phage FCL-2 (34) was added to the samples at a multiplicity of infection (MOI) of 1. For the phage UV treatment (52), phage FCL-2 was exposed to UV light for 5 min on a petri dish (5,000 μJ) (UV Stratalinker 1800; Stratagene), lowering the infectivity by roughly 2 orders of magnitude (data not shown). In the bacterium plus phage plus UV-phage treatments, wild-type phages were mixed with an equal volume of UV-treated phages from the same stock and dilution. Five bacterium-only and bacterium plus UV-phage cultures were established as controls. The cultures were incubated under agitation (120 rpm) at room temperature for 5 days, after which they were transferred (1:100) to 5 ml of 1× Shieh medium. After 2 days (day 7 from the beginning of the experiment), cell debris had sedimented at the bottom of the tubes. We sampled 1 ml of the clear phase for living planktonic cells and extracted DNA using a DNeasy blood and tissue kit (Qiagen). The cultures were also plated on Shieh agar plates with 10-fold dilutions to estimate CFU per milliliter and to perform colony PCR.

Colony PCR.

The variable ends of subtype II-C and VI-B CRISPR arrays were PCR amplified from colonies obtained under all conditions (total of 281 colonies) at day 7 (see Table S1A in the supplemental material) using primers C1_B185_F and C1_B185_R and primers C2_B185_F and C2_B185_R (Table S2A). Colonies with expanded arrays were recultured on Shieh agar plates, and the variable ends of the CRISPR arrays were rechecked. Colonies that still showed expanded arrays were grown in liquid medium, the DNA was extracted with a blood and tissue kit (Qiagen), and the variable ends were sequenced with the Sanger method using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) and the automated 3130xl genetic analyzer (Applied Biosystems) (Table S1B).

Population-level CRISPR deep sequencing.

Total DNA was extracted from 1-ml liquid samples using a DNeasy blood and tissue kit (Qiagen). The variable ends of subtype II-C and VI-B CRISPR loci (C1 and C2, respectively) from the phage and bacterium-only treatments were amplified with DreamTaq (Thermo Fisher Scientific), with one primer binding to the leader sequence (C2_B185_F and C1_B185_R) and one binding to the second (C1_B185_F) or third (C2_B185_R) spacer (Table S2A). The PCR protocol to amplify the CRISPR array associated with subtype II-C was as follows: 95°C for 3 min; 32 cycles of 95°C for 30 s, 59°C for 30 s, and 72°C for 1 min; and 72°C for 15 min. The PCR protocol to amplify the CRISPR array of subtype VI-B was as follows: 95°C for 3 min; 30 cycles of 95°C for 30 s, 60.2°C for 30 s, and 72°C for 1 min; and 72°C for 15 min. For subtype II-C, additional MgCl2 (4 mM) was required for amplification. To minimize PCR bias, four separate PCRs were performed for each of the five replicates, which were then pooled and cleaned using a Qiagen MinElute reaction cleanup kit. The resulting 10-μl samples were run on a 2% agarose gel (4.6 V/cm) for 2 h 45 min in Tris-acetate-EDTA (TAE) buffer. The expected PCR product sizes for the wild-type array (subtype II-C, 181 bp; subtype VI-B, 223 bp) as well as for the expanded arrays with one new repeat-spacer unit (subtype II-C, 246 bp; subtype VI-B, 289 bp) were extracted from the phage treatment using X-tracta (Sigma) extraction tools and a gel extraction kit (Qiagen) using MinElute columns (Qiagen). In the bacterium-only treatments, the wild-type PCR products from both loci were extracted as controls. All extractions underwent two gel purification rounds to reduce contamination.

For deep sequencing, we used the previously published pipeline for multiplexed Ion Torrent sequencing (4). The extracted PCR products from type VI-B were reamplified using Maxima Hot Start Taq DNA polymerase (Thermo Fisher Scientific), the primers M13-B185_223bp_C2F and P1-B185_223bp_C2R, as well as the IonA_bc_M13 primer that contained multiplexing barcodes and an M13 adaptor (Table S2A) (73). The following PCR program was used: 95°C for 5 min; 20 cycles of 94°C for 45 s, 53°C for 1 min, and 72°C for 1 min; and 72°C for 5 min. As we were unable to obtain amplification of the type II-C array with the above-described three-primer PCR approach, the PCR was split into two stages. First, type II-C PCR products were amplified using the primer pair M13-B185_C1_F3/P1-B185_181bp_C1R and the DreamTaq enzyme with added MgCl2 (4 mM) using the following program: 95°C for 5 min; 31 cycles of 95°C for 30 s, 59°C for 30 s, and 72°C for 1 min; and 72°C for 15 min. The reaction mixture was then purified with Agencourt AMPureXP (Beckman Coulter) and reamplified using primers IonA-bc_M13 (73) and P1-B185_181bp_C1R in a reaction identical to the three-primer reaction used for type VI-B. Finally, all samples were purified using AMPureXP and quantified with a Qubit fluorometer and a Qubit dsDNA HS kit. Equimolar amounts (5 ng) of PCR products were pooled for sequencing. Pooled PCR products were sequenced after emulsion PCR with the Ion OneTouch system and Ion OT2 400 kit (Life Technologies) on Ion 314 chips with the Ion PGM (personal genome machine) sequencing 400 kit (Life Technologies), according to the manufacturer’s instructions.

Deep sequencing data preparation.

Nontrimmed reads were obtained from PGM and sorted by their barcodes. Trimmomatic 0.36 (74) was used for quality control with the following parameters: SLIDINGWINDOW:3:21, MINLEN:100, and TRAILING:23. Spacers were extracted from the trimmed reads using a custom Python script that extracted 27- to 32-bp spacers between an intact first repeat and the first 4 nucleotides of the subsequent repeat. Due to short reads, a fully intact second repeat was usually not available. To obtain unique spacers, each spacer pool was clustered with CD-hit-est (75) using a clustering threshold of 0.8 and a word size of 5. The resulting spacers before and after filtering are listed in Table S2B.

Mapping.

The spacers were mapped to the previously published phage genome (59) using Bowtie 2.0 (76) with the following custom configuration: –very-sensitive-local –score-min G,10,8. The physical ends of the linear phage genome had been determined previously using a combination of next-generation sequencing and Sanger sequencing (59). Unmapped spacers were then mapped onto the bacterial genome, and the remaining unmapped reads (most probably due to poor sequence quality) were discarded. On average, 7.9% and 1.14% of unique spacers were discarded in the type II-C and VI-B loci, respectively. The genomes were divided into bins that span 3% of the respective genomes, and the protospacer count of each bin was calculated with a custom Python script. The resulting protospacer distribution on both genomes was illustrated using the ggplot2 package in RStudio 1.1.463 (R 3.5.3). The predicted origin of replication (oriC) region of F. columnare was determined using DoriC 10.0.0 (77).

PAM sequences.

With the aim of comparing PAM sequences between the loci, we report all PAM sequences based on flanking DNA (instead of RNA) regions due to the large proportion of only-DNA-targeting type VI-B spacers. Similarly, we follow the guide-oriented approach for both loci, as is common with DNA-targeting systems (56) (PAM is depicted on the noncomplementary strand with respect to the crRNA). All PAM sequences were extracted using custom Python scripts and shown using WebLogo (78).

Spacer pool identity level analysis.

To calculate the proportion of subtype VI-B spacers that are identical to II-C spacers, unique VI-B spacers from all replicates (b, d, and e) were first pooled. CD-hit-est was used to extract unique spacers from the pooled spacer set (clustering threshold of 0.8). The process was repeated for the type II-C spacers from replicates b and e. Next, the pooled unique spacer sets from both loci were compared to each other with CD-hit-est-2D using a similarity threshold of 0.9. The number of resulting clusters was then used to calculate the proportion of VI-B spacers that had a match in the type II-C spacer pool. Simulated sets of 430 spacers (the number of unique VI-B spacers pooled from all three replicates) were generated by sampling the phage genome either at random positions or from the 1,672 predicted PAM sites (5′-NNNNNTAAA-3′). Sampling was repeated 1,000 times, and similarities of the simulated spacers were compared with the type II-C spacer pool using CD-hit-est-2D as described above. A normal distribution was fit onto the simulated distributions using the R function fitdistr from the MASS package. The probability of the observed similarity, given the null hypothesis, between subtype II-C and VI-B spacers (0.58) was measured using the function pnorm from the upper tails of the distributions.

Proportions of mRNA-targeting spacers.

The ability of each spacer to target an ORF’s transcript was determined by two rules: (i) the crRNA of the spacer must be complementary to the coding strand, and (ii) the protospacer must be fully contained within an ORF. Intergenic spacers were excluded from the analysis. The number of mRNA-targeting spacers was divided by the total number of ORF-targeting spacers in the sample to obtain the proportion of mRNA-targeting spacers for each replicate separately. We also performed the analysis for pooled spacers from the replicates. Pools were made on the basis of locus and target, resulting in four pools (II-C phage, II-C self, VI-B phage, and VI-B self).

The mRNA proportions from pooled spacers were compared to a null hypothesis that assumed an equal chance of a spacer targeting both strands. Since intergenic spacers were excluded from the analysis, a binomial distribution could be used to construct the model. Separate distributions were created for each spacer pool to account for different numbers of spacers in each. The observed values in both loci were then compared to their respective distributions to yield direct P values on their probability given the null hypothesis described above (one-tailed test using the pbinom function in R). This analysis was done separately for the unique and absolute spacer counts.

RNA-seq and transcription direction.

The direction of CRISPR array transcription was determined from bacterial RNA sequencing (RNA-seq) data. F. columnare B185 was grown without phages in 10 ml of Shieh medium at 24°C with constant shaking at 150 rpm. Next, 24-h-grown cultures (optical density OD of 0.166 to 0.203) were centrifuged (5,000 rpm) and stored in RNAlater (Qiagen), until RNA was extracted with an Ambion MicrobExpress mRNA purification kit. RNA quality was verified using an Agilent Bioanalyzer 2100 RNA nanochip, and samples with RNA integrity values of >9.5 were selected for library preparation (Ion Total RNA-seq kit v2). The cDNA was sequenced with Ion Torrent using a 318 chip (v2) and an internal ERCC (External RNA Controls Consortium) spike-in control, after ensuring cDNA quality (Agilent Bioanalyzer 2100 DNA high-sensitivity chip). Our results support previous reports showing type VI-B crRNA transcription from the leader end (39) and type II-C transcription toward the leader end (starting from within each repeat) or the leader-distal end of the array (48) (Fig. S3). The RNA samples for this analysis were taken from three pooled cultures of F. columnare B185 in the absence of phages, showing that these arrays are expressed constitutively albeit at a very low level (reads mapping on arrays at 167.8 and 986.6 reads per million in II-C and VI-B, respectively).

cas1 deletion mutant.

Not all F. columnare strains accept plasmids by conjugation (54). As strain B185 was unable to receive plasmids via conjugation or electroporation (data not shown), we used strain B245 (34) to create the cas1 deletion mutant Δcas1. Due to its competence in plasmid conjugation, strain B245 was also used in the plasmid interference assay described below. The 2.1-kbp region upstream of cas1 was amplified by PCR using Phusion DNA polymerase (New England BioLabs) and primers 2322 (adding a KpnI site) and 2323 (adding a BamHI site). The PCR product was digested with KpnI and BamHI and ligated into the plasmid pMS75 (79) that had been digested with the same enzymes, to produce pRC30. A 495-bp region downstream of cas1 was PCR amplified using primers 2324 (adding a BamHI site) and 2325 (adding a SalI site) (Table S2A). The PCR product was digested with BamHI and SalI and ligated into pRC30 that had been digested with the same enzymes, to generate pRC32. The plasmid pRC32 was transferred from E. coli S17-1λpir into F. columnare strain B245 by conjugation. One milliliter of a culture of the recombinant E. coli strain grown overnight was inoculated into 9 ml of LB containing 100 μg/ml ampicillin and incubated with shaking at 37°C until the OD at 600 nm (OD600) reached 0.6. Similarly, 5 ml of a culture of F. columnare B245 grown overnight was inoculated into 25 ml fresh TYES (tryptone yeast extract salts) broth (80) and incubated at 28°C with shaking, until the OD600 reached 0.6. The E. coli and F. columnare cells were centrifuged separately at 5,000 rpm for 15 min, and the pellets were washed with 10 ml of TYES medium and centrifuged at 5,000 rpm for 10 min. The E. coli and F. columnare cell pellets were each suspended in 0.8 ml of TYES medium, mixed, and centrifuged at 7,000 rpm for 3 min. Excess medium was removed, and the mixed pellet was suspended and spotted on FCGM (Flavobacterium columnare growth medium) agar medium (80). After incubation at 30°C for 24 h, cells were scraped off the plate and suspended in 1.5 ml of TYES medium. Next, 100-μl aliquots were spread on TYES agar containing 1 μg/ml tobramycin and 5 μg/ml tetracycline and incubated at 30°C for 72 h. The resulting tetracycline-resistant colonies were streaked for isolation, inoculated into TYES liquid medium without tetracycline, and incubated overnight at 25°C with shaking to allow plasmid loss. The cells were plated on TYES medium containing 10% sucrose, incubated at room temperature (20°C) to select for the lack of sucrose toxicity, and streaked for isolation using the same selection. The cas1 deletion was screened by PCR and gel electrophoresis and verified with Sanger sequencing using primers Cas1_F and Cas1_R. All primers used are listed in Table S2A.

Strains used in the new spacer acquisition experiment were Δcas1 and B245rev (rev-wt). The latter is a reversion mutant where the integrated plasmid was lost by recombination in a manner that regenerated the wild-type sequence. Phage V156 (34) was used to trigger spacer acquisition. The infectivity of phage V156 against the two hosts (Δ_cas1 and rev-wt) was measured with a standard double-layer method, where 300 μl of a turbid bacterial culture was mixed with 3 ml of TYES medium with 0.1% mucin and 1% agar. The mixture was poured onto a TYES agar plate, and 10 μl of phage V156 dilutions (10−1 to 10−7) were spotted in duplicates onto the solidified agar. The number of plaques was counted after 2 days from the 10−7 dilutions. Phage titers (PFU per milliliter) were 1.9 × 1010 and 3.7 × 1010 on the Δcas1 and rev-wt strains, respectively.

For the spacer acquisition experiment, both strains were grown overnight in single 5-ml cultures to reach an OD600 of 0.45. Ten phage-infected cultures in 0.1× TYES medium as well as two bacterium-only cultures were started from these cultures grown overnight. The spacer acquisition protocol differed from the one used with B185, as follows: medium TYES (versus Shieh medium), volume of 1 ml (versus 5 ml), and duration of growth in 0.1× medium of 3 weeks (versus 5 days). The protocol was prolonged because follow-up experiments showed that longer incubation in diluted medium resulted in more efficient spacer acquisition. The medium or its volume has no detectable effect on the acquisition efficiency (data not shown) and was changed for practical reasons. After 3 weeks in diluted medium (0.1×), the cultures were transferred to regular TYES medium (1×), and the CRISPR arrays were PCR amplified after 2 days. All 12 phage-containing cultures of the Δcas1 strain showed growth in 1× medium, in contrast to only 2 of 12 replicates of the rev-wt cultures. The variable ends of both CRISPR arrays in all surviving cultures were PCR amplified using primers B245_C1_F and F_col_C1_R (B245 II-C array) and primers F_col_C2_F and B245_C2_R (B245 VI-B array) (Table S2A and Fig. S4).

Plasmid interference assay.

A derivative of plasmid pAS43 (54) (with a removed KpnI restriction site, not relevant to this experiment) was used as a template for adding a protospacer sequence followed by the putative PAM sequence 5′-NNNNNTAAA-3′. Two plasmids were constructed: one with a protospacer matching the most recent II-C spacer (next to the leader sequence) of F. columnare strain B245 (GGTAATTTTAAAACAAATGAGTATGTACGAACTGCTAAA the PAM sequence is underlined) and one with a nonmatching control sequence (ATCAGATCTAATCTCTATGTCAATGTATGAACTGCTAAA the PAM sequence is underlined). The insertions were added to the plasmid at an intergenic multiple-cloning-site region using the Q5 site-directed mutagenesis kit (New England BioLabs) and the oligonucleotide pair pAS43protoSDM_F/R (matching protospacer) or pAS43_protoSDM_neg_F/R (nonmatching protospacer) (Table S2A). The initial PCR was done using Phusion polymerase with 3% dimethyl sulfoxide (DMSO) using the following program: 98°C for 10 s and 24 cycles of 98°C for 1 s, 60°C for 7 s, 72°C for 12 min, and 72°C for 15 min. The amplified product was inspected on an agarose gel and subjected to downstream KLD (kinase, ligase and DpnI mix) treatment according to the mutagenesis kit instructions. The resulting plasmid was transformed into chemically competent _E. coli strain S17-1λpir. Successful transformation and insertion were verified by colony PCR and Sanger sequencing (primer pair pAS43_MCS2_seq_F/R) (Table S2A).

In the quantitative conjugation assay, the plasmids were transferred into F. columnare strain B245. Both the donor and the recipient cells were first grown overnight from a freezer stock. The turbid cultures were then transferred to fresh medium (LB for E. coli and TYES medium for F. columnare). E. coli was grown to an OD600 of 0.95, and the recipient F. columnare strain was grown to an OD600 of 0.414. The conjugation protocol was performed similarly to the cas1 deletion (described above), and the final donor/recipient mixtures were spotted on 0.45-μm filters resting on FCGM plates. After 24 h of growth at 30°C, the cells were scraped from the filters and resuspended in 2 ml TYES liquid medium. Next, 150 μl of the mixed cultures was plated on double-antibiotic selection plates without dilution (cefoxitin for conjugant selection and tobramycin for eliminating E. coli) as well as on tobramycin-only plates with 10−5 and 10−6 dilutions for determining the number of potential recipient cells in each replicate (F. columnare is naturally resistant to tobramycin). Colonies were counted and plates were photographed after 72 h at 25°C. The efficiency of conjugation was determined by dividing the number of F. columnare conjugants (double-selection plate) by the number of potential recipients (tobramycin plates) in each replicate.

Comparison of type II-C and VI-B leaders and repeats in other species.

Microbial species that carry intact subtype II-C (containing cas1, cas2, cas9, and a CRISPR array) and VI-B (containing cas13b and a CRISPR array) loci were identified using CRISPRCasdb (81), and one strain per species was selected for further analysis (Flavobacterium branchiophilum was excluded from the analysis due to the absence of cas1 in the subtype II-C locus). From each strain, repeat sequences from both loci were aligned with Geneious aligner (global alignment with free gaps, 51% cost matrix, gap open penalty of 12, and gap extension penalty of 3). Next, 200-bp leader sequences were extracted downstream of the expected variable end of the array. The variable ends were primarily determined by the repeats’ direction compared to F. columnare strain B185. These initial predictions were supported by the presence of possible degenerate terminal repeats and alignment scores of both flanking regions compared to the leader of F. columnare B185. To allow the comparison of the highly divergent leaders, the strains were first clustered based on their Cas1 protein (Jukes-Cantor, unweighted pair group method using average linkages UPGMA). The leaders from both loci within the resulting six clusters (most of which contained single species) were aligned with Geneious aligner (global alignment, 65% cost matrix, gap open penalty of 17, and gap extension penalty 12). We used strict alignment rules to emphasize the importance of the distance of possible motifs from the repeat-leader junction. Analyses and alignments were performed with Geneious 9.1.8.

Data availability.

The B245 genome and raw reads from the spacer acquisition experiment have been submitted to GenBank under accession numbers CP071008 and SAMN18022999, respectively. The genomes of F. columnare strain B185 (accession no. NZ_CP010992.1) and phage FCL-2 (accession no. NC_027125.1) are available in GenBank. Custom code and instructions for analyzing the raw data and reproducing all figures in the manuscript are in GitHub at https://github.com/vihoikka/spacerAQ_vh.

Article TitleCooperation between Different CRISPR-Cas Types Enables Adaptation in an RNA-Targeting System

Abstract

CRISPR-Cas immune systems adapt to new threats by acquiring new spacers from invading nucleic acids such as phage genomes. However, some CRISPR-Cas loci lack genes necessary for spacer acquisition despite variation in spacer content between microbial strains. It has been suggested that such loci may use acquisition machinery from cooccurring CRISPR-Cas systems within the same strain. Here, following infection by a virulent phage with a double-stranded DNA (dsDNA) genome, we observed spacer acquisition in the native host Flavobacterium columnare that carries an acquisition-deficient CRISPR-Cas subtype VI-B system and a complete subtype II-C system. We show that the VI-B locus acquires spacers from both the bacterial and phage genomes, while the newly acquired II-C spacers mainly target the viral genome. Both loci preferably target the terminal end of the phage genome, with priming-like patterns around a preexisting II-C protospacer. Through gene deletion, we show that the RNA-cleaving VI-B system acquires spacers in trans using acquisition machinery from the DNA-cleaving II-C system. Our observations support the concept of cross talk between CRISPR-Cas systems and raise further questions regarding the plasticity of adaptation modules.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.