Materials and Methods

A CRISPR-Cas9–integrase complex generates precise DNA fragments for genome integration

MATERIALS AND METHODSBacterial strains and growth conditions Staphylococcus aureus RN4220 (16) was cultured in heart infusion (HI) or broth heart infusion (BHI) at 37°C. For plasmid maintenance, 10 μg/ml chloramphenicol was added to the media when applicable. For all the infection experiments, phage ΦNM4γ4 was used (9).Plasmid constructionConstruction of the plasmids containing the Streptococcus pyogenes Type IIA CRISPR-Cas system with a single repeat and either wild-type Cas9 (pGG32) or dCas9 (pRH227) on the pC194 backbone (17) were described in a previous publication (9). Versions of pGG32 containing D10A Cas9 (pPM246) and H840A Cas9 (pPM247) were constructed from two-piece Gibson assemblies (18) by amplifying pGG32 with the primer pair H064-H295 and using either pRH202 or pRH203 amplified with H061-H296, respectively. pRH202 and pRH203 were also assembled using 2-piece Gibson reactions by amplifying pRH087 (9) with primer pairs L431-B337 and B295-B338 for pRH202 and with L431-B339 and B295-B340 for pRH203. Plasmids containing the S. pyogenes Type IIA (ΔCas1, ΔCas2 and ΔCsn2) with ΦNM4γ4 targeting spacers of different lengths were built by inserting the spacers in pBD184 (19) using BsaI cloning. The spacers were made and inserted in the plasmids by annealing the following primer pairs and ligating them in BsaI digested pDB184: PM1206-PM1207 (pPM235–30bp), PM1266-PM67 (pPM235–35bp), PM1268-PM1269 (pPM235–40bp) and PM1270-PM1271(pPM235–45bp). All the constructed plasmids were electroporated in S. aureus RN4220 as previously described elsewhere (19). A list of all oligonucleotide sequences used for PCR and molecular cloning in the S. aureus (in vivo) experiments are mentioned in Supplementary Table S1.Protein expression and purificationThe co-expression of the supercomplex was done using a construct containing His10-Cas9-Cas1-Cas2-Csn2 as reported earlier (9). The plasmid containing the co-expression vector was expressed in Escherichia coli BL21 Rosetta (DE3) cells. Cultures were induced for 16 h with isopropyl β-D-1-thiogalactopyranoside (IPTG) and the cells were lysed by sonication. The cell lysate was first purified by Ni-NTA affinity chromatography. The eluates were dialyzed and further subjected to ion-exchange chromatography by using Heparin columns. For ion-exchange chromatography, elution was performed using a concentration gradient with Buffer A (20 mM HEPES, 1000 mM NaCl, 1 mM TCEP, 1 mM EDTA, 5% glycerol at a pH of 7.4) and Buffer B (20 mM HEPES, 0 mM NaCl, 1 mM TCEP, 1 mM EDTA, 5% glycerol at a pH of 7.4). For binding and molecular weight measurements, the elution peak from the Heparin column containing all four proteins was mixed with a spacer and sgRNA of choice and incubated at 4C for 2 h before injecting into a Superdex 200 10/300 increase column. The buffer composition was 20 mM HEPES, 300 mM NaCl, 1 mM TCEP, 1 mM EDTA, 5% glycerol at a pH of 7.4. Variants of the supercomplex containing either Cas9 nickase (D10A or H840A) or a dCas9 (D10A and H840A) were created by introducing point mutations into the parent construct by golden-gate cloning and were purified using the protocol mentioned above. Cas1 and Cas2 proteins were purified using the same protocol as reported earlier (15).DNA and sgRNA preparationAll DNA oligonucleotides used in this study were synthesized by integrated DNA technologies. Prespacers were prepared by annealing the complementary strands in hybridization buffer (20 mM HEPES, 100 mM NaCl, 5 mM MgCl2, pH 7.4) and heating at 95°C for 5 min followed by slow cooling to room temperature. A list of all different prespacers used in this study have been shown in Supplementary Tables S2, S4, S5 and S6. The sgRNAs used in this study were synthesized by integrated DNA technologies. The sgRNA sequences used for all in vitro processing assays and for selection of full-site integration products are:Comp sgRNA:UCUUCGAAGACCGUUUCUUUGUUUUAGAGCUAUGCUGUUUUGAAAAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUCGNon-comp sgRNA:GCUUAGAUAGUCGAUAGCAUGUUUUAGAGCUAUGCUGUUUUGAAAAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUCGsgRNA scaffold:GUUUUAGAGCUAUGCUGUUUUGAAAAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUCGSEC-DALLS measurementStoichiometry determination of the supercomplex was performed using size-exclusion chromatography coupled to dual-angle laser light scattering. Supercomplex was first purified using Ni-NTA affinity chromatography followed by ion-exchange chromatography on a Heparin column. The purified fraction was complexed with a pre-spacer DNA and an sgRNA having sequence complementarity to the pre-spacer DNA being added. The complex was then injected into Superdex 200 10/300 Increase coupled to an Agilent 1260 Infinity Multi-Detector system. The buffer composition was 20 mM HEPES, 300 mM NaCl, 1 mM TCEP, 1 mM EDTA, 5% glycerol at a pH of 7.4. A 658 nm laser was used to perform light scattering. UV (280 nm), UV (260 nm) and light scattering signals at 90° were collected. The eluting fractions were analyzed to assess the molecular weights of the components. Bio-SEC software (Agilent) was used for data analysis and molecular mass calculations. In vitro prespacer processing assayFor prespacer processing experiments, Cas1-Cas2 integrase or the supercomplex with a complementary sgRNA/non-complementary sgRNA/sgRNA scaffold were incubated together at a concentration of 0.5 μM on ice for 1 h. The respective protein mixtures (Cas1 and Cas2) or the ribonucleoprotein complexes (supercomplex or Cas9) was incubated with 1 μM annealed prespacer substrates for 60 min at 37°C in processing buffer (HEPES 20 mM, KCl 200 mM, DMSO 10%, MgCl2 5mM, pH 7.4). The reactions were quenched with 25 mM EDTA and Proteinase K. Loading buffer containing bromophenol blue (BPB) was added to the reactions and heated at 80C for 10 min. The samples were then separated on 15% Urea-PAGE. Prespacer substrates used in all the processing reactions were unlabeled and the bands were visualized by post-staining the gels with SYBR gold. All the end-point experiments were performed at a 60-min time-point whereas the kinetic measurements were performed at time-points of 5, 10, 20, 40, 60 and 120 min. Quantitation of the processed products was performed from three replicates using Image lab software. Linear regression was used to determine the processing rates using Graph Pad Prism, 8.0.Selection for full-site integration productsPrespacer substrates were designed to facilitate Golden Gate-mediated insertion of a chloramphenicol selection cassette into pCRISPR (containing an Ampicillin cassette) only upon full-site integration of the prespacer by Cas1-Cas2 integrase or the supercomplex. Specifically, two abutted and inverted BbsI restriction sites were encoded in the center of each prespacer substrate, with overhangs designed to be complementary to the BbsI-generated overhangs at the edges of the chloramphenicol selection cassette. In total, the BbsI recognition and cleavage sites occupied the central 24 bp of each prespacer. In vitro integration reactions were performed with the designed prespacers as described in the section above. The reactions were quenched by the addition of 25 mM EDTA. The products of the integration reactions were purified using a DNA Clean and Concentrator 5 kit (Zymo Research) and eluted with 6 μl water. The purified products were subjected to a gap-filling reaction (20 μl total, 37 C for 30 min) in which 3′ ends were extended by a non-displacing DNA polymerase and nicks were ligated: 6 μl purified acquisition reaction, 2 μl Taq DNA ligase (80 U, NEB), 1 μl T4 DNA Polymerase (1 U, NEB), dNTP Solution Mix (1 mM each, NEB), 2 μl 10x Taq DNA Ligase buffer (NEB), 6.5 μl water. Gap-filling reactions were again purified using the Zymo Research kit as described above. A Golden Gate-compatible chloramphenicol cassette was generated by PCR using a forward primer:GGCCGAAGACGCAGATCTTATATCGTATGGGGCTGACTTCAGGTTGATCGGGCACGTAAGAGGTTCCand a reverse primer:GGCCGAAGACGCGAAACTTATATCGTATGGGGCTGACTTCAGGACCAATAAAAAACGCCCGGCencoding BbsI sites, and this amplicon was purified with the E.Z.N.A Cycle Pure Kit (Omega Biotek). The purified gap-filled products and chloramphenicol selection cassette were subjected to Golden Gate cloning using a standard BbsI assembly protocol.Golden Gate reactions were purified using the Clean and Concentrate 5 kit as described above, eluted in 6 μl H2O, and 3 μl was electroporated into 25 μl E. coli strain E. cloni 10G Elite electrocompetent cells (Lucigen). Electroporated cells were recovered in 975 μl pre-warmed Lucigen recovery medium for 1 h at 37 C, serially diluted in LB media, spot-plated (5 μl per spot) on LB agar containing 100 μg/ml carbenicillin and 25 μg/ml chloramphenicol and incubated overnight at 37 C. Individual colonies were picked into 1 ml TB medium containing carbenicillin and chloramphenicol in 96 deep well blocks (Costar) and grown in a shaking incubator (Multitron) overnight at 37°C and 750 rpm. Plasmids were purified and Sanger sequenced with primers binding inside the chloramphenicol resistance cassette and oriented outward toward the flanking CRISPR array:GGCCCGTCTCACTTTCATTGCCATACGAAATTCCGGATGAGCand GGCCCGTCTCGAAAGACGGTGAGCTGGTGATATGG.For each colony, the forward and reverse Sanger sequencing reads were concatenated and annotated using a reference feature database derived from known features on pCRISPR. Colonies were excluded from analysis if Sanger sequencing traces were low quality or uninterpretable; if the spacer was integrated at a site other than the edge of a direct repeat; if the integrated spacer was flanked by nonconsecutive spacers from the original CRISPR array; or, in rare circumstances, if mutations or indels in the prespacer ends were observed (likely stemming from oligonucleotide synthesis errors).Infection growth curvesOvernight cultures were diluted 1:100 in 5 ml of BHI with 5 mM CaCl2 and 10 μg/ml of chloramphenicol. The cultures were then grown for 1 h and 15 min and normalized to OD600 = 0.3. About 150 μl of each culture was added to three wells of a 96-well plate. When appropriate, bacteriophage was added directly to the well at a MOI of 1. Bacterial growth was monitored over time in a microplate reader (TECAN Infinite 200 PRO) by recording the OD600 of each well every 10 min.Plaque formation assayAbout 100 μl of an overnight culture mixed with melted 50% heart infusion agar with 5 mM CaCl2 and 10 μg/ml of chloramphenicol was plated on BHI plates. About 3 μl of 10-fold serial dilutions of phage were plated on the lawn of cells once the agar had solidified. The next day, photos of the plates were taken using a plate imager (FluorChem HD2).Spacer acquisition in S. aureusSpacer acquisition was performed as previously described (20) with slight modifications. Briefly, overnight cultures from single colonies were diluted 1:100 in BHI with 5 mM CaCl2 and grown for 1 h and 15 min. Then, the optical density (OD600) was recorded, and all the cultures were diluted to OD600 = 0.3. The cultures were infected with ΦNM4γ4 at a MOI of 100 for 30 min. Next, the cells were pelleted at 10 000 RPM for 3 min and flash frozen in liquid nitrogen. The frozen pellets were stored at -80°C until plasmid extraction for next-generation sequencing.PCR amplification of CRISPR loci for next-generation sequencingPlasmid from frozen RN4220 pellets were obtained using a modified QIAprep Spin Miniprep Kit protocol described elsewhere (21). PCR amplifications of the CRISPR loci were performed as previously described with slight modifications (20). Briefly, 250 ng of DNA was used for amplification with primer PM168 and a cocktail of three primers: PM375, PM376 and PM377. For each sample, a modified PM169 primer containing five random nucleotides and a unique 3–5 bp barcode at its 5′-end was used to track each sample in the sequencing data. The PCR products were analyzed on a 2% agarose gel and locations corresponding for expanded CRISPR loci were extracted. Samples preparation for high-throughput sequencing was performed exactly as previously described (20).High-throughput sequencing data analysisUsing a custom Python script, the spacer sequences aligning perfectly to ΦNM4γ4′s genome was extracted and the number of reads and the length for each spacer were recorded. The number of reads for each spacer sequence was normalized to account for PCR biased as previously described (21). For each sample, the number of unique spacer sequences with the same length was calculated and graphed as a percentage of all unique spacer sequences in that sample.

Article TitleA CRISPR-Cas9–integrase complex generates precise DNA fragments for genome integration

Abstract

The raw deep sequencing data collected for this study is available under the bioproject ID PRJNA670708.


Login or Signup to leave a comment
Find your community. Ask questions. Science is better when we troubleshoot together.
Find your community. Ask questions. Science is better when we troubleshoot together.

Have a question?

Contact support@scifind.net or check out our support page.