Hi all!

I’m working on a company called Trilobio to make fully automated biology accessible to everyone. With access to this technology, scientists can share experiments as code that runs the same way on everyone’s fully automated lab, helping make synthetic biology more reproducible. 

More specifically, we are building robotic modules that remove the need for expensive robotic integrators to achieve fully automated biology. Our modules snap together like LEGOs and can instantly transfer materials between each other. No need to hire a robotic integrator to put a robot arm between two isolated machines.  By building each module ourselves, we can make them really affordable too. Our first module has a robot arm in it which normally costs $30k off-the-shelf. By building this arm ourselves, we’re able to reduce the price to $600. 

We’re also building an App Store that runs on our modules, so instead of telling your robotic  modules to move liquid from one tube to the next, you can tell your modules to assemble a desired DNA sequence for you, or sequence an organism without needing to code at all. 

I wanted to share some of our progress! We’ve finished our prototype for our first automation module. The goal is for this module to be able to pipette from 0uL - 1000uL, move plates, open and close tubes, autocalibrate, and to reach into other modules to set up its own deck. It cost us ~$1k to build. Check out our booth at Synbiobeta!

**Our Booth + Prototype at Built with Biology 2022**

https://photos.app.goo.gl/WUKBDermX9LHNvYZA 

_Oakland, April 14th_

_Photo credit goes to Kyle Giffin of LatchBio_ ✨

Check out these videos to see our prototype in action! https://lnkd.in/gMrEEYS4 

The first app we’re working on is the biofoundry app. Keoni Gandall, one of our co-founders, wrote code that allowed for 700 different DNA sequences to be properly assembled in a week on existing robots with the help of just one lab tech. For reference, Ginkgo Bioworks assembles 750 DNA sequences a week. We’re working on building a user interface for this code and transitioning it to our own robotic modules so we can provide it as our first plug-and-play app to run on our first automation module. 

I’d love to learn more about the experiments that you run in your lab and about your thoughts on / experiences with lab automation! 

Fully automated biology for everyone 

Have you ever wanted to use AAV to deliver CRISPR to the liver (or other tissues) to knock out genes?

I recently published this with my old PhD mentor. The method is in an atherosclerosis methods book, but has all of our updated methods for designing, cloning, and validating CRISPR editing _in vivo_ making it applicable to anyone using CRISPR!

Methods for designing and using AAV-CRISPR

Perhaps not the traditional post on this platform, but I hope it'll provide you value nonetheless. 

 

**FACT:** Despite your communication & leadership abilities being THE most important thing for a career in academia or industry (yes, more important than your technical skillsets), many graduate programs fail to provide real-world opportunities for grad students to speak with non-technical audiences!

I know, I got my PhD 2 years ago and in hindsight I see the huge problem that it is. 

So a friend from grad school and I decided to do something about it - we built a program to connect you to non-scientist, to practice explaining complex ideas, increase your confidence public speaking, and upskill your teaching, communication, and engagement skills. 

And the best part is, we connect you to students! Young researchers who would love hearing from you and you will feel the gratification to see others learning and appreciating your work (a rarity for grad students lol!) 

Or perhaps the best part is that we give you a little extra cash on the side ;) we all know you can use a bump up for all the hard work you. 

Apply to join HELIX Connex: A virtual program for STEM graduate students & early-stage STEM professionals to share their work & career with young researchers. 

Your science doesn't matter, unless you can COMMUNICATE it

Check out this Views & News from GEN Biotechnology, the new peer review journal by Mary Ann Liebert Inc. and Genetic Engineering & Biotechnology News (GEN), to find out!

Can CRISPR bring us one step closer to a hypoallergenic cat? 

CRISPR-Cas are small RNA-based adaptive prokaryotic immunity systems protecting cells from foreign DNA or RNA. Type I CRISPR-Cas systems are composed of a multiprotein complex (Cascade) that, when bound to CRISPR RNA (crRNA), can recognize double-stranded DNA targets and recruit the Cas3 nuclease to destroy target-containing DNA. In theEscherichia colitype I-E CRISPR-Cas system, crRNAs are generated upon transcription of CRISPR arrays consisting of multiple palindromic repeats and intervening spacers through the function of Cas6e endoribonuclease, which cleaves at specific positions of repeat sequences of the CRISPR array transcript. Cas6e is also a component of Cascade. Here, we show that when mature unit-sized crRNAs are provided in a Cas6e-independent manner by transcription termination, the CRISPR-Cas system can function without Cas6e. The results should allow facile interrogation of various targets by type I-E CRISPR-Cas system inE. coliusing unit-sized crRNAs generated by transcription.

The Cas6e ribonuclease is not required for interference and adaptation by theE. colitype I-E CRISPR-Cas system

### Plasmid and strain construction

Plasmids and strains used in this study are provided in Supplementary Tables S1 and S2, respectively. Plasmids encoding unit-sized crRNA were constructed by cloning synthetic dsDNA duplex fragments (gBlocks from IDT Inc.) containing T7 A1 or _trp_ promoter and crRNA coding sequences followed by (T)8 track into EcoNI and KpnI sites of pACYCDuet-1 vector (Novagen). Three T7 A1 promoter containing plasmids were prepared: pG8_crRNA contains g8 spacer sequence targeting M13 phage DNA (genome positions 1358–1389); the plasmid pSpT5_crRNA contains T5 spacer sequence targeting T5 phage DNA (genome positions 1869–1900, complementary strand); the plasmid pSpλ_crRNA contains λ spacer sequence targeting phage λ DNA (genome positions 29798–29829, complementary strand). Spacer sequences were chosen based on the presence of functional PAM sequences upstream of corresponding protospacers in phage genomes. In plasmid pG8trp_crRNA, the g8 crRNA coding sequence was cloned under control of the _E. coli trp_ operon promoter.

Mutation C1T at the first position of the spacer was introduced into pG8_crRNA by QuickChange Site-Directed Mutagenesis Kit (Stratagene) according to manufacturer's protocol, creating plasmid pG8_crRNA_C1T. Plasmids encoding Cascade subunits and CRISPR cassette containing multiple g8 spacers are described in (5,8–9,23). The pT7Blue-based plasmids carrying a 209-bp M13 fragment with the g8 protospacer (genome positions 1311–1519) with or without an escape mutation C1T at the first position of the protospacer is described in (18).

Strains producing Cascade proteins for _in vitro_ experiments are described in (18,23). Strains KD390, KD477 and KD599 created for this work are derivatives of KD263 (18) and were constructed using the previously published Red recombinase protocol (24).

### RNA extraction and Northern blotting

The procedure was performed essentially as described (25). Total RNA was isolated from 2 ml of _E. coli_ cells grown until OD600 reached 1 and lysed by 5-min treatment using Max Bacterial Enhancement Reagent with subsequent purification by the TRIzol reagent (Invitrogen). RNAs bound to Cascade were extracted from purified complexes by TRIzol reagent. 10 μg of total RNAs or 20–40 ng of Cascade-purified RNAs were separated on a denaturing 8 M urea - 12% polyacrylamide gel and electrophoretically transferred to Hybond-XL membrane (GE Healthcare) using a Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad). The membrane was dried and then UV cross-linked. ExpHyb hybridization solution (Clontech) was used for hybridization according to manufacturer's instructions for 1 h at 37°C with 32P-end labeled g8-spacer specific probe (5′-GCGGGATCGTCACCCTCAGCAGCGAAAGACAG-3′).

### Cascade purification

Cascade or Cascade subcomplexes lacking Cse1, Cas6e, or Cas6e and Cse1 were prepared from cells co-expressing appropriate _cas_ genes (with or without a source of crRNA and were one-step affinity-purified on _Strep_-Tactin® column (IBA) using the N-terminal Strep-tag attached to the Cse2 subunit (23) according to manufacturer's protocol. N-terminal 6His-tagged Cse1 protein was IMAC purified from _E. coli_ KD418 strain and further purified using gel-filtration on Superdex 200 HiLoad 16/60 column (Amersham Biosciences) equilibrated with 20 mM HEPES-K buffer (pH 7.5) containing 150 mM NaCl. We also purified two Cascade forms (with and without Cas6e) from cells lacking any source of crRNA using a protocol published earlier (23).

### CRISPR interference and adaptation assays

_E. coli_ strain carrying a genomic CRISPR array with g8 spacer (KD263, (18)) or strains KD390, KD477 and KD599 which harbor only a CRISPR repeat in their genome and which were supplemented with plasmids encoding unit-sized crRNA were used to determine cell sensitivity to phage infection by a spot test method as described (8). To perform crRNA expression from the _trp_ promoter, KD390 cells transformed with the plasmid pG8trp_crRNA were grown in minimal medium M9 supplemented with 0.4% glycerol and 34 μg/ml chloramphenicol at 37°C until OD660 nm reached 0.5, then 3-β-indoleacrylic acid (IAA) was added to the final concentration 10 μg/ml for crRNA expression; IPTG and arabinose were added to 1 mM each to induce _cas_ genes expression. After 4 h induction the cells were used for plating and spot test with the M13 phage. Efficiency of plaquing was calculated as a ratio of the number of plaques formed on a lawn of tested cells to the number of plaques on sensitive (non-targeting, KD390) cell lawn. For each host-phage variant, plaquing efficiency was determined in at least three independent experiments. Escape phage plaques were analyzed by sequencing through the g8 protospacer region as described in (8). For plasmid transformation efficiency assays, competent pre-induced cells were prepared and electroporated with 10 ng of DNA from protospacer carrying plasmid (pG8, pG8_mut or pT7blue as a control). Transformation efficiency was determined as ampicillin-resistant colony numbers per μg DNA. The experiments were repeated at least three times.

To monitor CRISPR adaptation, KD263 cells and cells (KD390, KD477, KD599) carrying the pG8_crRNA plasmid were transformed with protospacer carrying plasmid pG8, individual colonies were selected, and grown overnight at 37°C in LB broth supplemented with 100 μg/ml ampicillin and 34 μg/ml chloramphenicol where needed. Aliquots of cultures were diluted 200-fold with fresh LB broth without ampicillin and supplemented with IPTG and arabinose to the final concentration 1 mM each. The cultures were grown at 37°C overnight. To monitor spacer acquisition, 1 μl of culture was added to 20 μl PCR reaction and amplification was performed with primers: Ec_LDR-F (5′-AAGGTTGGTGGGTTGTTTTTATGG-3′) and Ec_minR (5′-CGAAGGCGTCTTGATGGGTTTG-3′). PCR products corresponding to expanded CRISPR cassettes were gel purified using QIAquick Gel Extraction Kit (QIAGEN) and sequenced with MiSeq Illumina System at Moscow State University Genomics facility.

### _In vitro_ transcription

Double-stranded DNA fragment containing unit-sized g8 crRNA sequence flanked upstream with the T7 A1 promoter and downstream with (T)8 track was prepared by PCR amplification from pG8_crRNA plasmid. The resulting fragment had coordinates −96/+149 with respect to the transcription start site located at +1. To allow open complex formation, 3.3 nM transcription template was incubated with 100 nM of _E. coli_ σ70 RNA polymerase holoenzyme in 10 μl of transcription buffer containing 35 mM Tris-HCl, 70 mM NaCl, 7 mM MgCl2, 0.7 mg/ml BSA, (pH 7.9 at 25°C) for 10 min at 37°C. Transcription was initiated by the addition of NTPs (200 μM ATP and GTP, 100 μM CTP, and 10 μM of UTP). 5 μCi of [α-32P]-UTP (3000 Ci/mmol) was also added. After 5-min incubation at 37°C, reaction was terminated by the addition of equal volume of formamide. RNA products were separated by 20% polyacrylamide gel electrophoresis (PAGE) at denaturing condition (8 M urea) and analyzed by autoradiography.

### KMnO4 probing

The target g8 dsDNA (209 bp) was PCR amplified from pG8 plasmid containing g8 protospacer (Supplementary Table S1). The 5′ ends of the target ds-DNA fragment were labeled with 32P using T4 polynucleotide kinase for 30 min at 37°C (5–10 pmoles of 5′ termini in 30 μl reaction mixture containing 70 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 5 mM DTT, 10 pmoles [γ-32P]-ATP (6000 Ci/mmol)) and 10 units of T4 polynucleotide kinase (New England Biolabs). 32P-labeled DNA fragments were purified on micro Bio-SpinTM chromatography columns packed with Bio-Gel P-6 (BIO-RAD). Oxidative modification by KMnO4 was performed with 5-nM-labeled target DNA, 0.2–0.4 μM of Cascade complex and, where necessary, 0.5–1 μM crRNA in 10 μl binding buffer (40 mM Tris-HCl, pH 8.0, 50 mM NaCl). When chemically synthesized crRNA was added, Cascade and crRNA were first mixed and incubated at 37°C for 5 min to allow Cascade-crRNA complex formation. Target DNA was added to Cascade-crRNA complex and incubated at 37°C for 25–30 min. The probing reaction was initiated by adding KMnO4 to a final concentration of 2.5 mM. Reactions were incubated for 15 s at 37°C, quenched by the addition 10 μl of 1% β-mercaptoethanol and 5 μg of calf thymus DNA in 50 μl of 10 mM Tris-HCl (pH 8.5) and extracted with phenol-chloroform mixture, followed by ethanol precipitation. DNA pellets were dissolved in 100 μl of freshly prepared 1 M piperidine and heated in dry-bath at 95°C for 20 min. Piperidine was removed by chloroform extraction and DNA was ethanol precipitated. Pellets were dissolved in 10 μl of 10 mM Tris-HCl (pH 8.5) and supplemented with 15 μl of formamide loading buffer with Bromophenol Blue and Xylene Cyanol. Samples were separated by electrophoresis in 8% denaturing polyacrylmide gels containing urea. After electrophoresis, the gel was fixed in 10% acetic acid, dried and exposed to a phosphorus screen overnight. The images were scanned using PhosphorImager (Molecular Dynamics) and analyzed using ImageQuantMac v 1.2.

### High throughput sequence data analysis

Raw sequencing data were analyzed using ShortRead and BioStrings (26) packages. Illumina-sequencing reads were filtered for quality scores of ≥20 and reads containing two repeats (with up to two mismatches) were selected. Reads that contained 33-bp sequences between two CRISPR repeats were next selected and considered as spacers. Spacers were next mapped on the pG8 plasmid with no mismatches allowed. R scripts were used for spacers statistics and Circos (27) was used for graphical representation of the data.

Materials and Methods

L. donovani1 S/Cl2D,L. majorFriedlin v9, andL. mexicana(MNYC/BZ/62/M379) used in this study were routinely cultured at 27°C in M199 medium (pH 7.4) supplemented with 10% heat-inactivated fetal bovine serum, 40 mM HEPES (pH 7.4), 0.1 mM adenine, 5 mg liter−1hemin, 1 mg liter−1biotin, 1 mg liter−1biopterine, 50 U ml−1penicillin, and 50 µg ml−1streptomycin. Cultures were passaged to fresh medium at a 20-fold dilution once a week.Leishmaniacells after transfection with the CRISPR vector and donor DNA were sometimes cultured at 33°C or 37°C for 2 to 3 days to improve gene-editing efficiency (7).

Optimized CRISPR-Cas9 Genome Editing forLeishmaniaand Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms

### _Leishmania_ strains and culture medium. 

_L. donovani_ 1 S/Cl2D, _L. major_ Friedlin v9, and _L. mexicana_ (MNYC/BZ/62/M379) used in this study were routinely cultured at 27°C in M199 medium (pH 7.4) supplemented with 10% heat-inactivated fetal bovine serum, 40 mM HEPES (pH 7.4), 0.1 mM adenine, 5 mg liter−1 hemin, 1 mg liter−1 biotin, 1 mg liter−1 biopterine, 50 U ml−1 penicillin, and 50 µg ml−1 streptomycin. Cultures were passaged to fresh medium at a 20-fold dilution once a week. _Leishmania_ cells after transfection with the CRISPR vector and donor DNA were sometimes cultured at 33°C or 37°C for 2 to 3 days to improve gene-editing efficiency (7).

### Plasmid construction. 

All primer sequences used in this study are listed in the supplemental material (Data Sets S1 to S6).

The LdU6gRNAaH plasmid was generated as follows. (i) A 184-bp PCR fragment containing the 98-bp _L. donovani_ RNA polymerase III U6 promoter was amplified from _L. donovani_ genomic DNA with primers LdU6pF and LdU6pR, which also contains the _LdMT_ gRNAa guide coding sequence, and digested with HindIII and BbsI. (ii) The fragment from step 1 was cloned into the HindIII and BbsI sites of the pSPneogRNAH plasmid (7) after removing the 180-bp _L. donovani_ rRNA promoter to create the LdU6gRNAaH plasmid.

The humanU6gRNAa plasmid was generated as follows. (i) A 740-bp PCR fragment containing the human U6 promoter and gRNA coding sequence was amplified from plasmid pX330 (26) with primers pX330gRNAF1 and pX330gRNAR. (ii) The fragment from step 1 was digested and cloned into the HindIII and BamHI sites of pSPneo vector to create HumanU6gRNA plasmid. (iii) The _LdMT_ gRNAa guide coding sequence was then inserted into HumanU6gRNA plasmid after BbsI digestion.

The pLdCH plasmid was generated as follows. (i) A 495-bp PCR fragment containing the 180-bp _L. donovani_ rRNA promoter, the gRNA and HDV ribozyme coding sequences, and the 92-bp pyrimidine track was obtained from the pSPneogRNAH plasmid (7) with primers LdrRNApNde1 and pSPneoRHind3. (ii) The PCR fragment from step 1 was cloned into NdeI and HindIII sites of the pSP72 vector. (iii) The 6,595-bp HindIII and BglII fragment containing the Cas9 and hygromycin resistance genes from pLPhygCas9 (7) was subsequently cloned into the corresponding sites of the pSP72 vector in step ii to generate the pLdCH plasmid.

The pLdCN plasmid was generated as follows. (i) A 495-bp PCR fragment containing the 180-bp _L. donovani_ rRNA promoter, the gRNA and HDV ribozyme coding sequences, and the 92-bp pyrimidine track was obtained from the pSPneogRNAH plasmid with primers LdrRNApXho1 and pSPneoRHind3. (ii) The PCR fragment from step i was cloned into the XhoI and HindIII sites of pSP72 vector. (iii) The 4.4-kb CAS9 fragment from the pLPhygCas9 plasmid was cloned into the HindIII and BamHI sites of the pLPneo vector (49) to generate pLPneoCas9. (iv) The 6.4-kb HindIII and BglII fragment containing the Cas9 and neomycin resistance genes from the pLPneoCas9 plasmid was subsequently cloned into the corresponding sites of the pSP72 vector in step ii to generate the pLdCN plasmid.

The gRNA 241510+_MT_(gRNAa) coexpression vector was generated by inserting the 360-bp HindIII and BamHI fragment, which contains the LdrRNAP and gRNA 241510 coding sequence from the pSPneogRNA241510H plasmid (7), into the HindIII and BglII sites of the pSPneoHHgRNAaH plasmid (7) after removing the 180-bp LdrRNAP sequence.

The gRNA A2a+b coexpression vector was generated as follows. (i) A 276-bp PCR fragment containing gRNAA2a, HDV, and hammerhead ribozymes and the gRNAA2b guide coding sequences was amplified with primers Ld220670a and Ld220670b from the gRNA 241510+_MT_ coexpression vector. (ii) The PCR product from step i was digested with BbsI and inserted into the BbsI-digested pSPneogRNAH vector.

The gRNA A2a+b+_MT_(gRNAa) triple expression vector was generated by inserting the 579-bp HindIII and BamHI fragment which contained LdrRNAP, gRNA A2a+b, and ribozyme coding sequences from the gRNA A2a+b coexpression vector into the HindIII and BglII sites of pSPneoHHgRNAaH after removing the 180-bp LdrRNAP sequence.

### gRNA and primer design and synthesis. 

Since current gRNA design tools developed from data for higher-order eukaryotic cells are not necessarily suitable for _Leishmania_ (7), we selected gRNA guide sequences based on the relatively high activity scores in all of the following three design programs and no off-target site. The Eukaryotic Pathogen CRISPR guide RNA design tool (EuPaGDT) (http://grna.ctegd.uga.edu/) provides useful information on off-target sites and microhomology sequences flanking the DSB (9). The microhomology sequences are required for MMEJ but should be avoided if a donor will be used. Sequence scan for CRISPR (SSC) (based on human and mouse data; http://crispr.dfci.harvard.edu/SSC/) and CRISPRscan (based on zebrafish data; http://www.crisprscan.org/?page=sequence) are helpful for predicting gRNA activity based on the guide sequence alone (50, 51).

The primers for PCR were selected manually or via Primer3 (http://bioinfo.ut.ee/primer3/). All primers and oligonucleotides used in this study were ordered from Alpha DNA (Montreal, Canada).

### Other experimental procedures. 

The following experimental procedures were performed as previously described: single gRNA guide sequence cloning into various gRNA expression vectors (7); _Leishmania_ transfection and a limiting dilution assay to determine miltefosine resistance rates (7); _Leishmania_ genomic DNA extraction, PCR, and sequencing analysis (7); A2 Western blot analysis (14).

### RAD51 inhibition assay. 

The stock solutions (10 mM) of Rad51 inhibitors B02 and RI-1(catalog numbers SML0364 and 1274; Sigma) were prepared in dimethyl sulfoxide and stored at 4°C (42,–44). Immediately before use, the stock solutions were diluted with _Leishmania_ culture medium to a 1 mM working concentration for RI-1 and 100 µM for B02. These inhibitors were then directly added into Cas9 and _LdMT_ gRNAc-expressing _Leishmania_ culture (1 × 106 promastigotes per ml) to a final concentration 0 to 20 µM for B02 and 0 to 100 µM for RI-1. The proper concentrations of these inhibitors in culture were maintained by adding fresh inhibitors once every 3 days for a total 4 times in a 2-week period before measuring the miltefosine resistance rate.

### Generation of LdMT+/− single-knockout cells via the traditional gene replacement method. 

The specific _LdMT_ bleomycin-targeting fragment was generated by overlapping PCR. (i) The 666-bp _LdMT_ 5′ flanking sequence with primers Ld1315905′F and Ld1315905′R, the 534-bp bleomycin expression cassette with primers 131590BleF and 131590 BleR, and the 656-bp _LdMT_ 3′ flanking sequence with primers Ld1315903′F1 and Ld1315903′R were PCR amplified separately. (ii) The three PCR fragments from step i were mixed and used as PCR template for primers Ld1315905′F and Ld1315903′R to generate the specific 1,857-bp _LdMT_ bleomycin-targeting fragment. _L. donovani_ promastigotes transfected with this _LdMT_ bleomycin-targeting fragment were selected with 100 µg/ml phleomycin. The _LdMT+/−_ single-knockout clones were verified by PCR with primer pair Ld1315905′F1 and 131590BleR.

### Accession number(s). 

The pLdCN, pLdCH, and pSPneogRNA241510+MT plasmids have been deposited in Addgene under numbers 84290, 84291, and 84292, respectively. The partial sequences for these plasmids are provided in the supplemental material (Data Sets S3 and S5).

The DNA sequencing reads from JS26 and the raw reads from the RNA-sequencing experiment have been deposited in the NCBI SRA with the BioProject number PRJNA746619. Processed data files have been deposited in GEO under accession number{"type":"entrez-geo","attrs":{"text":"GSE186673","term_id":"186673"}}GSE186673. The JS26 genome has been deposited in the NCBI GenBank database with the accession number{"type":"entrez-nucleotide","attrs":{"text":"NC_053012.1","term_id":"1985467647","term_text":"NC_053012.1"}}NC_053012.1. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (90) partner repository with the dataset identifier PXD029878.

Type I CRISPR-Cas provides robust immunity but incomplete attenuation of phage-induced cellular stress

### Culture conditions and phage lysate preparation

_Serratia_ sp. ATCC 39006 (_Serratia_) and _Escherichia coli_ ST18 were grown overnight in lysogeny (LB) broth at 30 and 37°C, respectively in shaking conditions (160 rpm). When grown on plates, LB with agar (LBA, 1.5% w/v) was used and plates were incubated at an appropriate temperature until colony formation. When needed, antibiotics and supplements were added to the LB and LBA: Chloramphenicol (Cm; 25 μg/ml), Kanamycin (Km; 50 μg/ml), Tetracycline (Tc; 10 μg/ml), Gentamycin (Gm; 30 μg/ml) and 5-aminolevulinic acid (ALA; 50 μg/ml). New phage stocks were prepared as described elsewhere (23) using the double agar overlay method. Briefly, 100 μl of bacterial overnight culture and 100 μl of phage lysate were added to 4 ml of molten LBA overlay (0.35% w/v) and poured onto LBA plates. The phage concentration used was enough to produce almost confluent lysis. After an overnight incubation at 30°C, the overlays were pooled into a collection tube. Two drops of chloroform (NaHCO3-saturated) were added and the sample was vortexed to lyse the cells. Finally, cellular debris was removed by centrifugation (2000 _g_ for 20 min) and the phage stock was transferred into a new tube and stored at 4°C. To calculate the phage titre, 10-fold serial dilutions were made in phage buffer (10 mM Tris Base (pH 7.4), 10 mM MgSO4, 0.01% w/v gelatine) and spotted (20 μl) onto LBA overlay previously seeded with 100 μl of _Serratia_. After an overnight incubation at 30°C, plaques were counted and phage titre was expressed as plaque forming units (pfu)/ml.

### Primers, plasmids and strains

Primers, plasmids and strains used in this study are detailed in Supplementary Tables S1, S2 and S3, respectively.

### Phage isolation

Phage JS26 was isolated from sewage samples collected from the Tahuna Waste Water Treatment Plant in Dunedin, New Zealand (45°54'16.1‘S; 170°31'16.8’E). Enrichment for _Serratia_ phages was performed by inoculating an overnight _Serratia_ culture with 100 μl of sewage sample and incubating overnight at 30°C under shaking conditions (160 rpm). A 10-fold dilution series was prepared and plated onto a top agar overlay seeded with _Serratia_ overnight culture. Plaques showing different morphologies were picked and used to infect a new _Serratia_ culture. This step was repeated until homogenous looking plaques were obtained to ensure phage purity.

### Genome sequencing, annotation and comparative genomics

Phage genomic DNA (gDNA) was extracted from a high titre phage stock (∼109 pfu/ml) using the cetyltrimethylammonium bromide (CTAB) method described elsewhere (33). Samples were cleaned using the DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer's instructions and DNA was quantified using the Qubit dsDNA HS Assay Kit and the Qubit Fluorometer (2.0) (invitrogen) following the manufacturer's instructions. Isolated gDNA was sent to the Massey Genome Service (New Zealand) where libraries were prepared using the Nextera XT DNA Library Preparation Kit (Illumina), QC was checked with the Quant-iT dsDNA HS Assay for quantification and analysed using SolexaQA++, fastQC and fastQsceen. Sequencing was performed using Illumina MiSeq (2 × 150 bp) and the resulting reads were processed and trimmed using SolexaQA++ (v3.1.7.1). The genome was assembled using SPAdes 3.9 (34), annotated with RASTtk (2.0) (35) and manually curated using BLASTp (2.10.0) (Supplementary Table S5). To identify putative tRNAs, tRNAscan-SE v. 2.0 (36) was used. The final genome sequence was deposited in GenBank under the accession number MN505213.1 and visualized using EasyFig (2.2.2) (37). Related phages were identified using PAirwise Sequence Comparison (PASC) (38), the phylogenetic tree was built through whole genome blast using VIrus Classification and Tree building Online Resource (VICTOR) (39) using distance formula _d_6 and branch support was inferred from 100 pseudo-bootstrap replicates each and modified with FigTree (v1.4.3).

### Proteomics

A _Serratia_ culture (25 ml) was mixed with 500 μl of high titre phage stock (∼109 pfu/ml) and grown overnight at 30°C in shaking conditions (160 rpm). Cell debris were removed by centrifugation (2000 _g_ for 20 min) and the supernatant containing phages was concentrated and purified with a sucrose cushion. Briefly, phage samples were pipetted onto a 20% (w/v) sucrose solution underlay. The sample was separated by centrifugation (120 000 _g_ for 4 h at 20°C) and the pellet was resuspended in 250 μl of no-gelatin phage buffer and dialysed overnight against 2 l of milliQ water at 4°C. The phage solution was pooled together and cleaned from cell debris by centrifugation (10 000 _g_ for 20 min). Next, a CsCl gradient was prepared by adding 2 ml of 1.2 g/ml and 1.6 g/ml CsCl solutions into a centrifuge tube. The sample was separated by centrifugation (120 000 _g_ for 4 h at 20°C), and the white phage interface that formed in the CsCl gradient was harvested using a Pasteur pipette. The concentrated phage stock was washed by adding no-gelatin phage buffer and pelleted by an ultracentrifuge step (120 000 _g_ for 2 h at 20°C). The pellet was resuspended in 100 μl milliQ water and stored at 4°C. For the proteomic analysis, 75 μl of phage sample was mixed with 20 μl of 1/10 (v/v) β-mercaptoethanol 4× SDS-buffer and incubated for 5 min at 95°C. The sample was separated by electrophoresis in a 12% (w/v) SDS-polyacrylamide gel for 1 h at 150 V. Page ladder (Thermo Fisher Scientific) was used as a reference. The gel was fixed for 2 h in 10% (v/v) acetic acid, 40% v/v ethanol. Finally, the gel was stained overnight in four parts of Colloidal Coomasie Blue stain (0.1% G250 w/v, 10% w/v ammonium sulphate and 2% v/v _ortho_-phospholic acid) and one part methanol.

Proteomic analysis of the phage structural proteins was performed as described elsewhere (40). Briefly, the gel lane was subjected to in-gel digestion with trypsin and analysed by protein identification by liquid chromatography–coupled tandem mass spectrometry (LC–MS/MS) in the Centre for Protein Research (University of Otago). Peptide reconstruction was performed with an Ultimate 3000 nano-flow uHPLC-System (Dionex Co., Thermo Fisher Scientific; Waltham, MA, USA) in-line coupled to the nanospray source of an LTQ-Orbitrap XL mass spectrometer (Thermo Scientific; Waltham, USA). Raw spectra were processed through the Proteome Discoverer software (Thermo Fisher Scientific, Waltham, MA, USA) using default settings to generate peak lists. Peak lists were then searched against a combined amino acid sequence database containing all JS26 sequence entries (GenBank accession number MN505213.1, 84 entries) integrated into the full SwissProt/UniProt sequence database using the Sequest HT (Thermo Fisher Scientific), Mascot (www.matrixscience.com) and MS Amanda search engines (Supplementary Table S6).

### Electron microscopy

To examine phage by transmission electron microscopy (TEM), 10 μl of high titre phage stock (∼109 pfu/ml) was loaded onto plasma-glow discharged carbon coated 300 mesh copper grids. After 60 s, the excess specimen was removed by blotting and 10 μl of 1% (w/v) phosphotungstic acid (PTA) (pH 7.2) was applied to the grid to stain the samples and blotted off immediately. The grids were analyzed in the Otago Micro and Nano Imaging (OMNI) facility and viewed in a Philips CM100 BioTWIN transmission electron microscope (Philips/FEI Corporation, Eindhoven, Holland) and images captured using a MegaView lll digital camera (Soft Imaging System GmbH, Münster, Germany).

### Efficiency of plaquing assay

To assess phage infectivity in different _Serratia_ strains, an efficiency of plaquing (EOP) assay was performed. Serial 10-fold dilutions of high titre phage stocks (∼109 pfu/ml) were spotted onto LBA overlays seeded with _Serratia_ (100 μl). After the spots were dry, the plates were incubated at 30°C overnight. The EOP was calculated as the ratio between the pfu/ml in _Serratia_ strains and the wild-type control. All conditions were repeated in biological triplicates and the data was plotted as the mean ± SD.

### Phage infection time courses

_Serratia_ strains were grown to exponential phase (OD600 = 0.3) and diluted to an OD600 = 0.05. Bacterial cultures (180 μl) were pipetted into 96-well plates and infected with 20 μl phage lysate to produce a multiplicity of infection (moi) = 0, 1 and 10. The plates were incubated in a Varioskan Flash plate reader (Thermo Fisher Scientific) for 20 h at 30°C and shaking (240 rpm) and OD600 measurements were taken every 12 min. The experiment was repeated in biological triplicates and the data was plotted as the mean ± SD.

### Phage receptor characterization

Receptor identification was performed by transposon mutagenesis. Overnight cultures of donor (_E. coli_ ST18 pKRCPN2 carrying transposon Tn-DS1028_uidA_Km) and recipient (_Serratia_) strains were adjusted to an OD600 = 1, washed free from antibiotics and mixed in equal ratios. The samples were spotted (20 μl) onto LBA + ALA and incubated overnight at 30°C to allow conjugation. Next, the spots were scraped and resuspended in LB + Km to select for the transposon insertion events. The mutant pool was grown overnight and seeded onto an LBA overlay. High titre JS26 stocks (∼109 pfu/ml) were spotted (20 μl) onto the lawn and plates were incubated at 30°C until colonies appeared within the phage spot. Phage resistant mutants were restreaked onto a new plate to ensure purity.

Transposon insertion sites were identified by arbitrary PCR (41). A first round of random colony PCR was performed on phage resistant clones using a random primers PF106, PF107 and PF108 and transposon nested primers PF226 and PF1212. PCR products were cleaned using the GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare) and used as DNA template for a second round of PCR with adapter primer PF109 (that binds to the 5′ ends of PF106-PF108) and Tn-DS1028_uidA_Km nested primers (either PF226 or PF1212). Bands were extracted, sequenced and mapped against _Serratia_ genome to detect the transposon insertion site. EOP assay were performed on transposon mutants (PCF619, PCF620, PCF621, PCF623) to test phage resistance with an Δ_flhDC_ mutant (PCF879) used as a control. Moreover, the swimming ability of the mutants was evaluated in a motility assay. The mutants were stabbed onto LBA (0.35% w/v) and grown overnight at 30°C. Motility was assessed by measuring the halo of swimming from the inoculated spot and compared with a _Serratia_ WT as the control.

### One step growth curve

A _Serratia_ culture (25 ml) was grown up to exponential phase (OD600 = 0.3) and infected with JS26 at an moi = 0.1. The culture was incubated at 30°C in shaking conditions (160 rpm) and samples were taken at different time point (5, 20, 40, 60, 80, 100, 120 140, 160 min post infection (mpi)). At each time point, a 100 μl aliquot was taken and mixed with 900 μl of LB. The samples were immediately diluted in a 10-fold series and spotted (20 μl) onto LBA overlays previously seeded with _Serratia_. The experiment was repeated in three biological replicates and the data was plotted as mean of pfu/ml ± SD.

### Cell survival assay

To determine the moi at which synchronicity of infection was achieved, a cell survival assay was performed. _Serratia_ cultures (5 ml) were grown up to an early exponential phase (OD600 = 0.3) and infected with a range of moi (moi = 0, 0.1, 1, 25, 50). The infected cultures were incubated at 30°C, shaking (160 rpm) and samples were taken (500 μl) at time points 0, 5 and 25 mpi. The aliquots were mixed with 500 μl LB and centrifuged (17 000 _g_ for 2 min) to remove free phages. The bacterial pellet was washed with 1 ml of LB, resuspended in 500 μl LB and used to prepare in 10-fold serial dilutions. The bacterial dilutions were spotted (20 μl) onto LB plates. The percentage of cell survival was calculated as cfu/ml in infected samples/cfu/ml in uninfected control × 100%. The experiment was repeated in biological triplicates and the data was plotted as mean ± SD.

### Generation of native type I-E and I-F anti-phage strains

_Serratia_ strains harbouring anti-JS26 spacers (Supplementary Tables S3 and S4) in their type I-E and I-F chromosomal arrays (CRISPR1 and CRISPR2 respectively) were generated by primed spacer acquisition (42). Plasmids pPF1257 (type I-E priming vector) and pPF1258 (type I-F priming vector), carrying a phage fragment and a protospacer primed by a spacer in CRISPR1 and CRISPR2, respectively, were constructed as follows. A fragment (∼1 kb) of the tape measure gene (_gp61_) was amplified by PCR (using primers PF2296 and PF2297) from phage gDNA and digested with SpeI and KpnI. The insert was cloned into the two priming vectors (pPF1125 and pPF1126) previously digested by the same enzymes. Plasmids were transformed into _E. coli_ ST18, plated onto LBA + ALA + Cm and cloning was checked by PCR using primers PF1403 and PF1372, and confirmed by sequencing. The resulting plasmid was conjugated into _Serratia_ by mixing equal ratios of donor and recipient strains and spotting mating spots onto LBA + ALA and incubated at 30°C overnight. The mating spots were streaked onto LBA + Cm to select for transconjugants.

Colonies were grown overnight in LB in the absence of antibiotic selection to allow for plasmid targeting and cultures passaged overnight for 2–3 days. Aliquots were taken each day, and dilutions were plated onto LBA and LBA + Cm to check for plasmid loss. Array expansion was checked by PCR screening with PF1989/PF1887 (CRISPR1) and PF1990/PF1888 (CRISPR2), and acquisition of anti-JS26 spacers was confirmed by sequencing.

### RNA extraction and sample preparation and RNA-seq analysis

_Serratia_ WT or anti-JS26 strains (PCF524 and PCF525) were grown to exponential phase (OD600 = 0.3) in 25 ml LB at 30°C and in shaking conditions (160 rpm). Cultures were infected at an moi = 50 and 2 ml samples were taken at 0 (prior to phage infection), 5, 20 and 40 mpi. Immediately after extraction, the samples were centrifuged (17 000 _g_ for 1 min at 4°C) to remove the free phage and the bacterial pellet was resuspended in 2 ml of RNAlater (Invitrogen) and stored at –20°C. The experiment was repeated in biological triplicates.

Total RNA was extracted using the RNeasy kit (QIAGEN). Briefly, samples resuspended in RNAlater were harvested by centrifugation (17 000 _g_ for 1 min at 4°C) and resuspended in 250 μl of 10 mM Tris–HCl (pH 8.0). The resuspended pellet was transferred to a pre-chilled bead beater tube containing 350 μl of RLT buffer (lysis buffer) and β-mercaptoethanol. Cell lysis was performed with a bead beater, using three 10 s pulses interspaced by a 1 min incubation in ice. The samples were chilled for 3 min on ice and cellular debris was removed by centrifugation (17 000 _g_ for 1 min at 4°C). The homogenate was transferred into a clean Eppendorf and 1.5× volume of 100% ethanol was added and mixed by vortexing. The sample was transferred into the RNeasy mini spin column, centrifuged (>8000 _g_ for 15 s) and the flow through discarded. Next, the column was washed twice with 500 μl of Buffer RPE (washing buffer) followed by centrifugation (>8000 _g_ for 15 s). RNA was eluted by adding 50 μl of RNase free water followed by centrifugation (>8000 _g_ for 1 min). The sample was treated with TURBO DNase (Invitrogen) following the manufacturer's instructions. Finally, impurities were removed by centrifugation (>8000 _g_ for 1 min) and the RNA samples were transferred to a new tube and stored at –20°C.

The absence of DNA contamination was confirmed by PCR using primers PF796 and PF797 that amplify a fragment encoding the _flhDC_ genes in _Serratia_. RNA concentration was estimated using a nanodrop and the quality assessed by an RNA nano chip on the Bioanalyzer (Agilent). The total RNA samples were ribo-depleted using Ribo-zero rRNA removal kit (epicentre) and directional cDNA libraries were prepared with the TruSeq stranded mRNA library preparation kit (Illumina) following manufacturer's instructions.

The samples were sequenced in the Otago Genomic Facility (OGF, New Zealand) using Illumina HiSeq 2500 v4 Rapid single-read sequencing, with ∼10 million reads (101 bp) generated per sample. The reads were trimmed using Trimmomatic (43) and their quality evaluated through FASTQC analysis. Finally, raw sequence reads were aligned to _Serratia_ (accession number CP025085) and JS26 (accession number MN505213.1) genomes using Bowtie2 with default parameters (44). The alignment was converted to BAM files format using SAMtools (45). The differential expression between the uninfected controls (timepoint 0) and the infected samples (5, 20 and 40 mpi) was evaluated using the DESeq2 (46) R/Bioconductor package (3.5.2) with a Wald test, followed by a Benjamini and Hochberg procedure. All sets were defined by a false discovery rate of 10%. Genes differentially expressed in _Serratia_ WT and anti-JS26 I-E and I-F strains are listed in Supplementary Tables S7, S8 and S9, respectively. Classification of differentially expressed genes was performed using the gene set enrichment analysis platform (GSEA-pro V3.0) using operon, Gene Ontology (GO) (47) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) (48) databases.

### Adaptation assay

To determine if the phage-encoded _cas4_ homologue affected spacer acquisition in _Serratia_, _cas4_ was cloned into an overexpression vector under an arabinose inducible promoter (with _cas4_, pPF2291; empty vector, pPF783) and overexpressed during adaptation assays. The _cas4_ gene was amplified from JS26 gDNA through PCR using primers PF4692 and PF4693. Gibson assembly (NEBuilder HiFi DNA Assembly) was used to clone the insert into the expression vector pPF783 previously digested with restriction enzymes EcoRI and SphI. The construct was transformed into _E. coli_ ST18 and conjugated into _Serratia_. Adaptation assays during _cas4_ overexpression were performed as previously described (22). Briefly, plasmids pPF719 and pPF953 (non-targeted ‘naïve’ control), pPF1233 and pPF1048 (high and medium ‘primed’ type I-E) and pPF1242 and pPF1243 (high and medium ‘primed’ type I-F) were conjugated from _E. coli_ ST18 into _Serratia_ carrying pPF783 or pPF2291. Transconjugants were streaked onto LBA with Tc and Gm to ensure maintenance of the two plasmids. Single colonies were used to inoculate 5 ml LB cultures supplemented with arabinose (0.05% w/v) and Gm. These were incubated overnight at 30°C under shaking condition (160 rpm) and passaged for 3 days by daily transfer of 10 μl of culture into 5 ml of fresh LB supplemented with arabinose (0.05% w/v) and Gm. CRISPR array expansion was determined by PCR directly on cells from passaged cultures using primers PF633 and PF2177 for the type I-E array (CRISPR1) and PF1888 and PF1990 for the type I-F array (CRISPR2). PCR products were run on 3% agarose gels with a 1 kb + DNA ladder (invitrogen), stained with ethidium bromide and visualized under UV light. The experiment was performed in biological triplicates.

### CRISPRi of the phage _cas4_ homologue

To determine if the JS26 _cas4_ homologue was required for phage replication, EOP and phage infection time courses were performed on _Serratia_ carrying a dCas9 expression vector with (pPF2786) or without (pPF1755) a single guide RNA (sgRNA) targeting the _cas4_ homologue in JS26. EOP and phage infection time courses experiments were performed as previously described with the addition of arabinose (0.1% w/v) to induce expression of dCas9 and Km for plasmid maintenance.

Chronic hepatitis B virus (HBV) infection persists due to the lack of therapies that effectively target the HBV covalently closed circular DNA (cccDNA). We used HBV-specific guide RNAs (gRNAs) and CRISPR-Cas9 and determined the fate of cccDNA after gene editing. We set up a ribonucleoprotein (RNP) delivery system in HBV-infected HepG2-NTCP cells. HBV parameters after Cas9 editing were analyzed. Southern blot (SB) analysis and DNA/RNA sequencing (DNA/RNA-seq) were performed to determine the consequences of cccDNA editing and transcriptional activity of mutated cccDNA. Treatment of infected cells with HBV-specific gRNAs showed that CRISPR-Cas9 can efficiently affect HBV replication. The appearance of episomal HBV DNA variants after dual gRNA treatment was observed by PCR, SB analysis, and DNA/RNA-seq. These transcriptionally active variants are the products of simultaneous Cas9-induced double-strand breaks in two target sites, followed by repair and religation of both short and long fragments. Following suppression of HBV DNA replicative intermediates by nucleoside analogs, mutations and formation of smaller transcriptionally active HBV variants were still observed, suggesting that established cccDNA is accessible to CRISPR-Cas9 editing. Targeting HBV DNA with CRISPR-Cas9 leads to cleavage followed by appearance of episomal HBV DNA variants. Effects induced by Cas9 were sustainable after RNP degradation/loss of detection, suggesting permanent changes in the HBV genome instead of transient effects due to transcriptional interference.

CRISPR-Cas9 Targeting of Hepatitis B Virus Covalently Closed Circular DNA Generates Transcriptionally Active Episomal Variants

### Cell lines, viral inoculum, and infection conditions. 

HBV particles were concentrated from the supernatant of HepAD38 cells (HBV genotype D; kind gift from C. Seeger [Fox Chase Cancer Center, USA]) (36) by filtering and PEG precipitation (37). HepG2-NTCP cells (kind gift from S. Urban [Heidelberg University, Germany]) (38) were seeded at 105 cells/cm2 in growth medium (Dulbecco’s modified Eagle medium [DMEM]; high glucose, 1% penicillin-streptomycin, 1% sodium pyruvate, 1% glutamine [Life Technologies], 5% fetal calf serum [HyClone fetal clone II]). From the next day onward, cells were cultured in medium complemented with 2.5% dimethyl sulfoxide (DMSO) (Sigma) as a standard method to increase HBV infection without affecting cell viability (39). After 72 h, cells were infected at a multiplicity of infection of 1,000 (4% PEG, 16 h). For protocol 1, infected cells were replated at 3 dpi at 5 × 104 cells/cm2. At 4 dpi, cells were transfected with RNPs, and medium was replaced 24 h posttransfection (hpt). Supernatants and cells lysates were collected at 7 dpi (4 dpt) or 14 dpi (10 dpt). When indicated, cells were treated with 3TC (10 μM) from 4 dpi until cell collection. In protocol 1, for the “rebound control with or without (+/−) 3TC” condition, 3TC was present for 3 days and then removed for a week. For protocol 2, 3TC was added at 4 dpi and cells were replated at 6 dpi at 8 × 104 cells/cm2 in the continuous presence or absence of 3TC.

### gRNA design, RNP assembly, and transfection. 

The CRISPR RNA (crRNA) sequences for Sp1 to Sp8 were adapted from published studies (40,–42), while Sp9 to Sp12 gRNA sequences were designed using the online Benchling platform minimizing homology to the human genome. crRNAs, Neg1 and -2, _trans_-activating crRNA (tracrRNA)-ATTO550, and _Streptococcus pyogenes_ (S.py) Cas9 protein (WT and dead) were purchased from IDT-DNA. gRNAs were _in vitro_ assembled by mixing equimolar concentrations of crRNA and tracrRNA (with or without ATTO550, as indicated) at a final concentration of 30 nM, with heating and cooling down at room temperature to allow formation of heteroduplexes. JetCRISPR (PolyPlus transfection) was used for forward transfection in infected HepG2-NTCP cells.

### Real-time PCRs. 

RNA and DNA were extracted using the Macherey-Nagel NucleoSpin RNA kit and the Epicentre MasterPure kit, respectively. Real-time PCRs were performed as previously described (43). The 3.5-kb RNA was normalized to the housekeeping gene beta-glucuronidase (GUSB) (Hs99999908_m1; Thermo Fisher Scientific). Total HBV DNA was measured using TaqMan assay Pa03453406_s1 (Life Technologies). For cccDNA quantification, incomplete double-stranded circular DNA was degraded by ExoI+III treatment, and primers targeting a specific region in cccDNA were used (44) (forward, 5′_CCGTGTGCACTTCGCTTCA_3′; reverse, 5′_GCACAGCTTGGAGGCTTGA3_′; probe, 5′[6FAM]_CATGGAGACCACCGTGAACGCCC_[BBQ]). Serial dilutions of an HBV plasmid served as an external quantification standard. Total DNA or cccDNA was normalized to human beta globin (HBB) (Hs00758889_s1; Thermo Fisher Scientific).

### ELISAs for viral antigens. 

Enzyme-linked immunosorbent assays (ELISAs) for HBeAg and HBsAg detection in cell supernatants were performed according to the manufacturer’s protocol using the chemiluminescence immunoassay (CLIA) kit from Autobio Diagnostic. All measurements were performed after 3 days of accumulation in medium.

### Southern blotting. 

Cells (2 × 107) were processed using a modified Hirt extraction followed by ExoI+III digestion (45). Samples were then quantified by Qubit, and ND2 qPCR was used to normalize the seeding amount to mitochondrial DNA. Samples were run in a 1.2% agarose gel for 16 h at 15 V. Samples in the agarose gel were depurinated using HCl followed by NaOH treatment and neutralization before transfer to a nylon membrane using a Whatman Turbo blotter. Membranes were blocked and incubated with branched-DNA probes to detect the negative-strand HBV DNA with modifications of the protocol described in reference 46 or with digoxigenin (DIG) DNA probes as described in reference 47.

### RNA sequencing. 

RNA was extracted using TRIzol followed by Turbo I DNase treatment. An RNA integrity number of >9.6 was confirmed with a Bioanalyzer prior to submission to Genewiz. cDNA libraries were constructed using a NEBNext Ultra RNA library preparation kit with rRNA depletion. Paired-end sequencing was conducted using Illumina MiSeq with a read length of 150 bp (average of ∼100 × 106 reads/sample). Sequencing reads were aligned to the human and HBV reference genome (GenBank no. U95551.1) using STAR (48). To calculate the frequency, two variant callers (Pindel and HaplotypeCaller) were used to determine the number of reads supporting a given mutation. The ratio of mutations to the total number of reads (mutated or not) was then manually calculated using the data provided by the variant callers. For the CRISPR variants, custom reference genomes were generated based on the expected cleavage sites of S.py Cas9 (−3 from the PAM) followed by recircularization of each double-cleaved fragment. Coverage calculation per position was performed using GenomeCov from the toolkit bedtools. The original coverage per position in the genome ranged from 2,000 to 15,432.

### Amplicon sequencing. 

Nuclear extraction of 6 × 106 cells was performed in cell lysis buffer (5 mM PIPES, 85 mM KCl, 0.5% NP-40, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1× protease inhibitor cocktail [PIC; Thermo Fisher]). After “tight” treatment with Dounce and centrifugation (10 min, 4,500 rpm), nuclei were resuspended in 1× Tris-EDTA (TE) buffer. Episomal DNA was enriched using a modified Hirt extraction (45), followed by phenol-chloroform DNA purification, ExoI+III digestion, and Zymo column cleanup. Primers pairs for nested PCR using HiFi Q5 polymerase were designed to flank Sp5 and Sp7 target sites for on-target amplicon sequencing. To calculate the frequency, two variant callers (Pindel and HaplotypeCaller) were used to determine the number of reads supporting a given mutation. The ratio of mutations to the total number of reads (mutated or not) was then manually calculated using the data provided by the variant callers. For the CRISPR variants, same primers were combined in different pairs around the novel predicted junctions. Amplicons of around 300 bp were then submitted for next-generation sequencing (NGS) to Genewiz facilities (Amplicon-EZ) (Fig. S8E).

### Statistical analysis. 

Statistical analysis was performed using Prism 7 software (GraphPad Software, San Diego, CA, USA). The Kruskal-Wallis test and Dunn’s multiple-comparison test were used to compare numerical data.

### Data availability. 

DNA amplicon-sequencing and RNA sequencing data are be available at the European Nucleotide Archive (ENA) under accession number PRJEB51625.

CRISPR-Cas immune systems adapt to new threats by acquiring new spacers from invading nucleic acids such as phage genomes. However, some CRISPR-Cas loci lack genes necessary for spacer acquisition despite variation in spacer content between microbial strains. It has been suggested that such loci may use acquisition machinery from cooccurring CRISPR-Cas systems within the same strain. Here, following infection by a virulent phage with a double-stranded DNA (dsDNA) genome, we observed spacer acquisition in the native host _Flavobacterium columnare_ that carries an acquisition-deficient CRISPR-Cas subtype VI-B system and a complete subtype II-C system. We show that the VI-B locus acquires spacers from both the bacterial and phage genomes, while the newly acquired II-C spacers mainly target the viral genome. Both loci preferably target the terminal end of the phage genome, with priming-like patterns around a preexisting II-C protospacer. Through gene deletion, we show that the RNA-cleaving VI-B system acquires spacers in _trans_ using acquisition machinery from the DNA-cleaving II-C system. Our observations support the concept of cross talk between CRISPR-Cas systems and raise further questions regarding the plasticity of adaptation modules.

Cooperation between Different CRISPR-Cas Types Enables Adaptation in an RNA-Targeting System

Hexose transporter-deficient yeast strains are valuable testbeds for the study of sugar transport by native and heterologous transporters. In the popularSaccharomyces cerevisiaestrain EBY.VW4000, deletion of 21 transporters completely abolished hexose transport. However, repeated use of theLoxP/Cre system in successive deletion rounds also resulted in major chromosomal rearrangements, gene loss and phenotypic changes. In the present study, CRISPR/SpCas9 was used to delete the 21 hexose transporters in anS. cerevisiaestrain from the CEN.PK family in only three deletion rounds, using 11 unique guide RNAs. Even upon prolonged cultivation, the resulting strain IMX1812 (CRISPR-Hxt0) was unable to consume glucose, while its growth rate on maltose was the same as that of a strain equipped with a full set of hexose transporters. Karyotyping and whole-genome sequencing of the CRISPR-Hxt0strain with Illumina and Oxford Nanopore technologies did not reveal chromosomal rearrangements or other unintended mutations besides a few SNPs. This study provides a new, ‘genetically unaltered’ hexose transporter-deficient strain and supplies a CRISPR toolkit for removing all hexose transporter genes from mostS. cerevisiaelaboratory strains in only three transformation rounds.

A toolkit for rapid CRISPR-SpCas9 assisted construction of hexose-transport-deficientSaccharomyces cerevisiaestrains

### Strains, media and storage

The _Saccharomyces cerevisiae_ strains used in this work belong to the CEN.PK family (Entian and Kötter 2007; Salazar _et al._2017) and are listed in Table 1. The strains were grown at 30°C in 500 mL flasks containing 100 mL chemically defined medium (synthetic medium, SM) (Verduyn _et al._1992) or yeast extract peptone (YP) medium supplemented with 20 g L−1 glucose (YPD) or 6.8 g L−1 maltose (YPM) in an Innova incubator shaker (New Brunswick Scientific, Edison, NJ) set at 200 rpm. SM contains 3 g L−1 KH2PO4, 0.5 g L−1 MgSO4·7H2O, 5 g L−1 (NH4)2SO4, 1 ml L−1 of trace element solution and 1 ml L−1 of vitamin solution as described in (Verduyn _et al._1992). YP medium contains 10 g L−1 yeast extract and 20 g L−1 peptone. When required, SM was supplemented with 150 mg L−1 uracil, 125 mg L−1 histidine, 500 mg L−1 leucine and/or 75 mg L−1 tryptophan (Pronk 2002).

### Table 1.

Strains used in this study.

**NameRelevant genotypeParental strainOrigin**CEN.PK113-7D_MAT_a _URA3 TRP1 LEU2 HIS3_(Entian and Kötter 2007)CEN.PK2-1C_MAT_a _ura3-52 trp1-1 his3_Δ(Entian and Kötter 2007)CEN.PK122_MATa/MATα_(Entian and Kötter 2007)EBY.VW4000_MAT_a _ura3-52 trp1-1 leu2-3,112 his3_Δ _hxt13_Δ_::loxP hxt15_Δ_::loxP hxt16_Δ_::loxP hxt14_Δ_::loxP hxt12_Δ:_:loxP hxt9_Δ_::loxP hxt11_Δ_::loxP hxt10_Δ::_loxP hxt8_Δ_::loxP hxt4-1-5_Δ_::loxP hxt2_Δ_::loxP hxt3-6-7_Δ_::loxP gal2_Δ _stl1_Δ_::loxP agt1_Δ_::loxP mph2_(_ydl247w_)Δ_::loxP mph3_(_yjr160c_)Δ_::loxP_CEN.PK2-1C(Wieczorke _et al._1999)IMX672_MAT_a _ura3-52 trp1-1 leu2-3,112 his3_Δ _can1_Δ_::Spcas9-natNT2_CEN.PK2-1C(Mans _et al._2015)IMX1521_MAT_a _ura3-52 trp1-1 leu2-3,112 his3_Δ _can1_Δ_::Spcas9-natNT2 gal2_Δ _hxt4-1-5_Δ _hxt3-6-7_Δ_::ars4 hxt8_Δ _hxt14_ΔIMX672This studyIMX1541_MAT_a _ura3-52 trp1-1 leu2-3,112 his3_Δ _can1_Δ_::Spcas9-natNT2 gal2_Δ _hxt4-1-5_Δ _hxt3-6-7_Δ_::ars4 hxt8_Δ _hxt14_Δ _hxt2_Δ _hxt9_Δ _hxt10_Δ _hxt12_Δ _hxt13_Δ _hxt15_Δ _hxt16_ΔIMX1521This studyIMX1812_MAT_a _ura3-52 trp1-1 leu2-3,112 his3_Δ _can1_Δ_::Spcas9-natNT2 gal2_Δ _hxt4-1-5_Δ _hxt3-6-7_Δ_::ars4 hxt8_Δ _hxt14_Δ _hxt2_Δ _hxt9_Δ _hxt10_Δ _hxt11_Δ _hxt12_Δ _hxt13_Δ _hxt15_Δ _hxt16_Δ _mph2_(_ydl247w_)Δ _mph3_(_yjr160c_)Δ _mal11_Δ _stl1_ΔIMX1541This studyOpen in a separate window

To obtain solid media, 2% (w/v) agar was added. Yeast strains and _Escherichia coli_ cultures were stored by adding glycerol to the cultures to a final concentration of 30% (v/v) and stored at –80°C.

### Molecular biology techniques

Plasmids were isolated from _E. coli_ with the GenElute Plasmid Miniprep Kit (Sigma Aldrich, St. Louis, MI) according to the supplier's instruction. DNA amplification was performed by PCR using Phusion® High-Fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, MA) as previously described (Mans _et al._2015). Separation of DNA fragments was done in 1% (w/v) agarose gel (Thermo Fisher Scientific) with SERVA DNA Stain Clear G in 1x TAE buffer (Thermo Fischer Scientific). DNA fragments were isolated from gel using the Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA). DNA concentrations were measured with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Plasmids were constructed _in vitro_ with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, Beverly, MA) according to manufacturer's protocol, but with reaction volumes down-scaled by 4-fold. Colony PCR was performed using DreamTaq PCR Master Mix (2x) (Thermo Fisher Scientific). Following the manufacturer's instruction. Yeast transformation was performed with the LiAc/ssDNA method (Gietz and Woods 2002). Yeast genomic DNA was extracted as previously described (Lõoke, Kristjuhan and Kristjuhan 2011) prior to colony PCR.

### Plasmid construction

The double sgRNA method for CRISPR/_Sp_Cas9-mediated deletions based on pROS plasmid series (Mans _et al._2015, 2018) was used to construct several sgRNA plasmids. The guide RNA sequences were selected to perform the 21 hexose transporter deletions in a minimal number of transformation rounds. Based on alignments of _HXT_ gene sequences, considering sequences with AT content above 65% and the absence of strong secondary structures, 11 sgRNAs were designed (sgRNA labelled 1 to 11, Fig. 1B) to yield a kit of six sgRNA-carrying plasmids.

  Figure 1.

(**A**) Overview of the chromosomal localization of the deleted hexose transporters. Genes indicated with the same color were removed in the same deletion round. Red, first round; blue, second round; green, third round. (**B**) Deletion strategy. The scissors indicate the gene targeted by _Sp_Cas9 editing. The circled numbers indicate the sgRNA used to guide _Sp_Cas9 for editing.

The sgRNA plasmids were assembled _in vitro_ from two DNA parts (using NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs). The first part was the plasmid backbone obtained by PCR with Phusion polymerase, using a single primer (6005, Supplemental Material 1) binding at each of the two _SNR52_ promoters of either pROS10, pROS14 or pROS16 (Table 2; Mans _et al._2018). The second part was a 2 μm fragment surrounded by two sgRNA sequences. This fragment was obtained by PCR amplification (DreamTaq polymerase) of the 2 μm of pROS10 using primers containing the specific 20 bp sgRNA recognition (target) sequence and a 50 bp sequence, homologous to the linearized plasmid backbone. Plasmid assembly was followed by chemical transformation to chemically competent _E. coli_ XL1-blue cells according to the supplier's instructions (Agilent Technologies, Santa Clara, CA) for storage and plasmid propagation, in Lysogeny Broth (LB) medium with 100 mg L−1 ampicillin.

### Table 2.

Plasmids used in this study.

**NameRelevant characteristicsAddgene #Origin**pRS416_CEN6/ARS4_ ampR _URA3_(Sikorski and Hieter 1989)pROS102 μm ampR _URA3_ sgRNA-_CAN1_.Y sgRNA-_ADE2_.Y#107924(Mans _et al._2015)pROS142 μm ampR _KlLEU2_ sgRNA-_CAN1_.Y sgRNA-_ADE2_.Y#107928(Mans _et al._2015)pROS162 μm ampR _HIS3_ sgRNA-_CAN1_.Y sgRNA-_ADE2_.Y#107930(Mans _et al._2015)pUDR2112 μm ampR _KlLEU2_ sgRNA3-_HXT8_ sgRNA4-_HXT14_#113870This studypUDR2142 μm ampR _URA3_ sgRNA5- _HXT13-15-16_ sgRNA6-_HXT2_#113871This studypUDR2172 μm ampR _HIS3_ sgRNA9-_MPH2-3_ sgRNA10-_MAL11_#113872This studypUDR2202 μm ampR _KlLEU2_ sgRNA8-_HXT10_ sgRNA7-_HXT9-11-12_#113873This studypUDR2952 μm ampR _HIS3_ sgRNA2-_GAL2_ sgRNA1-_HXT4-1-5;HXT3-6-7_#113874This studypUDR4182 μm ampR _URA3_ sgRNA11-_STL1_ sgRNA11-_STL1_#113875This studyOpen in a separate window

The _E. coli_ colonies were picked and mixed directly in the DreamTaq PCR mix, containing primers binding to the specific 20 bp recognition sequence (primers 11662-11670, 11756) together with two primers binding in the plasmid backbone (primers 4034 and 5941), confirming the presence of one or two target sgRNAs. This PCR will result in four products, since the sgRNA primer can bind on either side of the 2 μM fragment. The orientation of the 2 μm fragment was confirmed by restriction with FastDigest enzymes (Thermo Fisher Scientific) following the supplier's manual. All primers for plasmid construction, diagnostic PCR and sequencing are listed in Supplemental Material 1.

The plasmids pUDR211 and pUDR220 were constructed by _in vitro_ assembly with the backbone of pROS14 (_KlLEU2_, Addgene plasmid #107928; Mans _et al._2018) and insert fragment amplified with primers containing the _HXT8_ (primer 9575) and _HXT14_ (9577) recognition sequences and primers containing the _HXT10_ (9576) and _HXT9_, _HXT11_, _HXT12_ (9572) recognition sequences, respectively. Similarly, the plasmids pUDR214 and pUDR418 were constructed with the pROS10 backbone (_URA3_) (Addgene plasmid #107924; Mans _et al._2018) and insert fragment amplified with primers containing spacer sgRNA targeting _HXT2_ (9574) and _HXT13_, _HXT15_, _HXT16_ (9573) recognition sequences and insert fragment amplified with primers containing the spacer sgRNA targeting _STL1_ (primer 13616) respectively (Fig. 1). The plasmids pUDR217 and pUDR295 were constructed with the pROS16 backbone (_HIS3_, Addgene plasmid #107930; Mans _et al._2018) and insert fragments amplified with primers containing spacers sgRNA targeting _MPH2_, _MPH3_ (primer 9579) and _MAL11_ (primer 9585) recognition sequences and insert fragments amplified with primers containing spacers sgRNA targeting _GAL2_ and _HXT1,3-7_ respectively. Plasmid confirmation was performed by Sanger sequencing (using primers 2758, 6197, 8556 and 2918) (BaseClear B.V., Leiden, The Netherlands).

### Strain construction

The CRISPR/_Sp_Cas9 system with double sgRNA-containing plasmids was used to delete 21 genes in the quadruple auxotrophic strain IMX672 in three transformation rounds (Mans _et al._2015). As described above, six sgRNA expression plasmids were constructed, pUDR211, pUDR214, pUDR217, pUDR220, pUDR295 and pUDR418 (Table 2). Strains were transformed with combinations of two plasmids together with double-stranded DNA fragments (repair DNA) designed to repair the double strand break created by _Sp_Cas9. With one exception, repair DNA was a 120 bp oligonucleotide sequence composed of two adjacent 60 bp sequences homologous to sequences located up- and downstream of the DNA break. To prepare the repair DNA fragments, two 120 bp complementary single-stranded oligonucleotides (Supplemental Material 1) were heated for 5 min at 95°C and then cooled to room temperature. To confirm correct annealing, the dsDNA concentration was measured with Qubit fluorometer 2.0 and Qubit dsDNA BR Assay kit (Thermo Fisher Scientific). Deletion of the adjacent _HXT3_, _HXT6_ and _HXT7_ resulted in the loss of _ARS432_. To prevent potential replication problems, the repair DNA carried _ARS4_, amplified by PCR from pRS416 with primers 9525 and 9526. Transformation of _S. cerevisiae_ was performed as previously described (Gietz and Woods 2002).

The first transformation was accomplished with 1 μg of each plasmid pUDR211 and pUDR295 (Table 2), together with 2 μg of each corresponding repair oligonucleotide (Supplemental Material 1). The gene deletions were confirmed by PCR and plasmids were subsequently removed by growing one positive clone in 100 mL YPM medium at 30°C with aeration until the end of the exponential growth on glucose. This procedure was repeated by inoculating 1 μL of the culture to a new 100 mL YPM flask. At the end of the exponential growth phase, the culture was plated on YPM agar to obtain single colonies. Plasmid loss was confirmed by re-streaking single colonies on plates with selective and non-selective media. A single colony, unable to grow on selective medium, was inoculated in liquid YPM and grown overnight in an incubator at 30°C. The strain was stocked as IMX1521 and used for the second round of transformation, in which 2 μg of each plasmid, pUDR214 and pUDR220, and 2 μg of each corresponding repair oligonucleotide were transformed. The genotype was confirmed by PCR and the plasmids were recycled as described above, resulting in strain IMX1541. This strain was transformed with 2 μg of each plasmid pUDR217 and pUDR418, and with 2 μg of each corresponding repair oligonucleotide. The genotype was confirmed by PCR and the plasmids were removed, resulting in strain IMX1812. For the second and third transformation rounds, liquid and solid cultures were supplied with maltose as carbon source.

### CHEF electrophoresis

For chromosome separation, contour-clamped homogeneous electric field (CHEF) electrophoresis was used. The CHEF Yeast Genomic DNA Plug Kit (Bio-Rad, Richmond, CA) was used to prepare 1% agarose plugs as recommended by the supplier. The agarose plugs were placed in a 1% megabase agarose gel in 0.5x TBE buffer (Thermo Fisher Scientific), together with the Lambda PFG Ladder (New England Biolabs). The CHEF-DRIII Pulsed Field Electrophoresis system (Bio-Rad) chilled to 14°C was used with a voltage of 5 V/cm, a pulse angle of 120° and pulse time of 60 s during 28 h followed by a pulse time of 90 s for another 16 h. The CHEF gel was stained in 200 mL 0.5x TBE with 3 μg mL−1 ethidium bromide followed by de-staining in 200 mL 0.5× TBE. Images were taken using a UV transilluminator.

### Flow cytometric measurement of DNA content

A sample of an exponentially growing aerobic shake-flasks culture was washed with demineralized water, fixed in 70% ethanol and stored at 4°C. Approximately 1 × 107 ethanol-fixed cells were washed with 50 mM Tris-HCl buffer at pH 7.5. The pellet was suspended in the same buffer supplemented with 1 mg mL−1 RNase A and incubated at 37°C for 2 h. Trypsin was added to a final concentration of 3.3 mg mL−1, and the cell suspension was incubated at 37°C for 2 h. Cells were subsequently washed with 50 mM Tris-HCl pH 7.5 buffer, suspended to a final concentration of 2 × 107 cells per mL in 50 mM Tris-HCl pH 7.5 buffer and stored on ice. A total of 2 × 106 cells were mixed in 50 mM Tris-HCl pH 7.5 buffer with or without 1μM Sytox Green Nucleic Acid stain (Sigma), sonicated at 6 μm peak-to-peak amplitude (MSE Soniprep 150, Fisher Scientific, Loughborough, United Kingdom) for 15 s and stored on ice. Analysis was done on a BD-AccuriTM C6 flow cytometer equipped with a 488 nm excitation laser (Becton Dickinson, Franklin lakes, NJ). A minimum of 1000 events were analyzed in FlowJo v10.4.1 (FlowJo LLC, Ashland, OR) to determine the DNA content of the constructed strains. Exponentially growing aerobic shake-flask cultures of the haploid _S. cerevisiae_ strain CEN.PK113-7D and the diploid strain CEN.PK122 were used to identify the fluorescence intensity corresponding to 1 and 2 N peaks, respectively.

### Whole genome sequencing

#### Illumina sequencing 

Genomic DNA of IMX1812, IMX672, IMX1541 and CEN.PK2-1C was isolated using the Qiagen 100/G Kit (Qiagen, Hilden, Germany) following the manufacturer's recommendations. DNA concentration was quantified using a Qubit® Fluorometer 2.0 with Qubit dsDNA BR Assay kit. The genomic DNA of IMX1812 was used to obtain a 300 cycle paired-end library with insert-size of 550 bp and sequenced in-house on a MiSeq sequencer (Illumina, San Diego, CA) using TruSeq DNA PCR-free library preparation. Sequence data are available at NCBI under Bioproject accession number PRJNA478763.

#### MinION sequencing 

For Nanopore sequencing, a 1D sequencing library (SQK-LSK108) was prepared according to the manufacturer's recommendation, shearing DNA with g-TUBE (Covaris Ltd, Brighton), and loaded onto an FLO-MIN106 (R9.4) flow cell, connected to a MinION Mk1B unit (Oxford Nanopore Technology, Oxford, UK). MinKNOW software (version 1.11.5; Oxford Nanopore Technology) was used for quality control of active pores and for sequencing. Raw files generated by MinKNOW were base called, on a local compute server (HP ProLiant DL360 G9, 2x XEON E5-2695v3 14 Cores and 256 GB RAM), using Albacore (version 1.2.5; Oxford Nanopore). Reads, in fastq format, with minimum length of 1000 bp were extracted, yielding 7.15 Gigabase of sequence with an average read length of 7.3 kb. Sequencing data are available at NCBI under Bioproject accession number PRJNA478763.

#### _De novo_ assembly 

_De novo_ assembly was performed using Canu (v1.4, settings: genome size = 12 m) (Koren _et al._2017) producing a 12.16 Megabase genome. Paired-end Illumina library was aligned, using BWA (Li and Durbin 2010), to the assembly and the resulting BAM file (Binary Alignment Map file) was processed by Pilon (Walker _et al._2014) for polishing the assembly (for correcting assembly errors), using correction of only SNPs and short indels (–fix bases parameter). Gene annotations were performed using the MAKER2 annotation pipeline (version 2.31.9) (Holt and Yandell 2011) using SNAP (version 2013–11-29) (Korf 2004) and Augustus (version 3.2.3) (Stanke _et al._2006) as _ab initio_ gene predictors. S288C EST and protein sequences were obtained from SGD (_Saccharomyces_ Genome Database, http://www.yeastgenome.org/) and were aligned using BLASTX (BLAST version 2.2.28+) (Camacho _et al._2009). Translated protein sequences of the final gene model were aligned using BLASTP to S288C protein Swiss-Prot database. Custom made Perl scripts were used to map systematic names to the annotated gene names.

#### Analysis of copy number variation 

Illumina reads from IMX1812 and CEN.PK2-1C were co-assembled to detect copy number variation between the two strains by applying the Magnolya algorithm (Nijkamp _et al._2012).

### Growth tests on solid media

Cells from a frozen stock were inoculated in liquid YPM or SM medium supplemented with maltose, uracil, histidine, leucine and tryptophan and grown aerobically at 30°C, 200 rpm. After 8 h, the optical density at 660 nm was measured with a JENWAY 7200 spectrophotometer (Cole-Parmer, Stone, UK). An appropriate volume of cell suspension was spun down (3000 g, 2 min at 4°C) and washed with sterile water, then transferred to a fresh 500 mL shake flask with an initial OD660 of 0.5 and cultivated for 4 hours at 30°C. After measuring OD660 in triplicate, cells were collected by centrifugation (3000 g, 2 min at 4°C), washed with sterile water and resuspended to a concentration of 107 cells mL−1. From this cell suspension, a 10x serial dilution was prepared in water with final concentration of 103 cells mL−1. Then, 10 μL of each concentration were spotted on selective SM agar plates supplemented with uracil, tryptophan, leucine and histidine with 20 g L−1 glucose, 6.8 g L−1 maltose, 20 g L−1 mannose, 20 g L−1 galactose, or 20 g L−1 fructose as carbon source and grown for 2 days at 30°C.

### Growth test in shake flask

All liquid cultures with SM were supplemented with uracil, histidine, leucine and tryptophan and grown aerobically in 500 mL shake-flasks at 30°C, 200 rpm. For growth rate determination, cells were inoculated from a frozen stock culture in 100 mL SM medium with 6.8 g L−1 maltose as carbon source. After 8 h of incubation, optical density at 660 nm was measured with a JENWAY 7200 spectrophotometer. Cells were transferred to an initial OD660 of 0.01 and grown overnight in the same medium. The next morning, exponentially growing cultures were transferred to fresh 100 mL SM maltose medium (initial OD660 ∼0.1) and the OD was monitored over time. For growth tests with glucose as carbon source, cells were washed once in water and inoculated to an OD660 of 0.2 in SM with 20 g L−1 glucose. OD660 was monitored until stationary phase was reached. Specific growth rates were calculated from at least six data points evenly distributed during the exponential growth phase.

Samples were taken and spun down (3 min at 13,000 g) for substrate and extracellular metabolite concentration determination by high-performance liquid chromatography (HPLC) analysis. HPLC analysis was performed with an Agilent 1100 HPLC (Agilent Technologies) equipped with an Aminex HPX-87H ion-exchange column (Bio-Rad, Veenendaal, The Netherlands) kept at 60°C, eluted with sulfuric acid (5 mM, 0.6 mL min−1). Detection of glucose, ethanol and glycerol was performed by a refractive-index detector (Agilent G1362A).

Anti-CRISPR (Acr) proteins are encoded by many mobile genetic elements (MGEs) such as phages and plasmids to combat CRISPR–Cas adaptive immune systems employed by prokaryotes, which provide powerful tools for CRISPR–Cas-based applications. Here, we discovered nine distinct type II-A anti-CRISPR (AcrIIA24–32) families from _Streptococcus_ MGEs and found that most Acrs can potently inhibit type II-A Cas9 orthologs from _Streptococcus_ (SpyCas9, St1Cas9 or St3Cas9) in bacterial and human cells. Among these Acrs, AcrIIA26, AcrIIA27, AcrIIA30 and AcrIIA31 are able to block Cas9 binding to DNA, while AcrIIA24 abrogates DNA cleavage by Cas9. Notably, AcrIIA25.1 and AcrIIA32.1 can inhibit both DNA binding and DNA cleavage activities of SpyCas9, exhibiting unique anti-CRISPR characteristics. Importantly, we developed several chemically inducible anti-CRISPR variants based on AcrIIA25.1 and AcrIIA32.1 by comprising hybrids of Acr protein and the 4-hydroxytamoxifen-responsive intein, which enabled post-translational control of CRISPR–Cas9-mediated genome editing in human cells. Taken together, our work expands the diversity of type II-A anti-CRISPR families and the toolbox of Acr proteins for the chemically inducible control of Cas9-based applications.

Discovery of potent and versatile CRISPR–Cas9 inhibitors engineered for chemically controllable genome editing

Mechanistic insights into the role of the human microbiome in the predisposition to and treatment of disease are limited by the lack of methods to precisely add or remove microbial strains or genes from complex communities. Here, we demonstrate that engineered bacteriophage M13 can be used to deliver DNA toEscherichia coliwithin the mouse gastrointestinal (GI) tract. Delivery of a programmable exogenous CRISPR-Cas9 system enables the strain-specific depletion of fluorescently marked isogenic strains during competitive colonization and genomic deletions that encompass the target gene in mice colonized with a single strain. Multiple mechanisms allowE. colito escape targeting, including loss of the CRISPR array or even the entire CRISPR-Cas9 system. These results provide a robust and experimentally tractable platform for microbiome editing, a foundation for the refinement of this approach to increase targeting efficiency, and a proof of concept for the extension to other phage-bacterial pairs of interest.

Phage-delivered CRISPR-Cas9 for strain-specific depletion and genomic deletions in the gut microbiome

New tools for genetic manipulation of _Mycobacterium tuberculosis_ are needed for the development of new drug regimens and vaccines aimed at curing tuberculosis infections. Clustered regularly interspaced short palindromic repeat (CRISPR)–CRISPR-associated protein (Cas) systems generate a highly specific double-strand break at the target site that can be repaired via nonhomologous end joining (NHEJ), resulting in the desired genome alteration. In this study, we first improved the NHEJ repair pathway and developed a CRISPR-Cas-mediated genome-editing method that allowed us to generate markerless deletion in _Mycobacterium smegmatis_, _Mycobacterium marinum_, and _M. tuberculosis_. Then, we demonstrated that this system could efficiently achieve simultaneous generation of double mutations and large-scale genetic mutations in _M. tuberculosis_. Finally, we showed that the strategy we developed can also be used to facilitate genome editing in _Escherichia coli_.

A CRISPR-Assisted Nonhomologous End-Joining Strategy for Efficient Genome Editing inMycobacterium tuberculosis

### Strains, media, and growth conditions. 

_E. coli_ strain MG1655, _M. marinum_ strain M, _M. bovis_ BCG, _M. tuberculosis_ strains H37Ra and H37Rv, _M. smegmatis_ strain mc2155, and their derivatives were used in this study. Unless otherwise indicated, _M. tuberculosis_ H37Ra was used. _M. smegmatis_ was grown in Middlebrook 7H9 broth (Difco) supplemented with 0.05% Tween 80 and 0.2% glycerol or on Middlebrook 7H10 plates supplemented with the appropriate antibiotics. _M. marinum_, _M. bovis_ BCG, and _M. tuberculosis_ were grown in Middlebrook 7H9 broth (Difco) supplemented with 0.05% Tween 80, 0.2% glycerol, and oleic acid-albumin-dextrose-catalase (OADC; Becton Dickinson) or on 7H10 plates supplemented with the appropriate antibiotics, 0.5% glycerol, and OADC (Becton Dickinson). When indicated, antibiotics and small molecules were used at the following concentrations: kanamycin (25 μg/ml), hygromycin (50 μg/ml), zeocin (50 μg/ml), and anhydrotetracycline (ATc) (50 ng/ml).

### Plasmids. 

pMV261-Cas12a and pCR-Hyg (or pCR-Zeo) were used in _M. marinum_. The genes encoding the MmNHEJ machinery (_MMAR_457_3, _MMAR_4574_, and _MMAR_4575_) were amplified from the _M. marinum_ chromosome. Plasmids containing _cas9_Sth1 were originally obtained from pLJR965 (48). pNHEJ-Cas12a-_recX_ and pNHEJ-Cas12a-_recA_mu (or pNHEJ-Cas9Sth1-_recX_) were used in _M. smegmatis_, and pYC1655 was constructed to express the cognate sgRNA. pNHEJ-_recX-sacB_ (or pNHEJ-_recA_mu-_sacB_) were used in _M. tuberculosis_. A codon-optimized _cas9_ gene under the control of the TetR-regulated promoter and the sgRNA cassette under the control of an optimized TetR-regulated promoter were cloned into a plasmid harboring the pMF1 replicon (51) to yield pYC1640 (or pYC2085). The sgRNA cassette contains two BbsI restriction sites for insertion of the target sequence. A _recX_ allele was amplified from the _E. coli_ chromosome and cloned into pZCas9 (23) to create pZCas9-_recX_. All plasmids used in this study are described in Table S4 in the supplemental material. Details of plasmid constructions are available upon request.

#### TABLE S4

Plasmids used in this study. Download Table S4, PDF file, 0.2 MB.

Copyright © 2020 Yan et al.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

### Genome editing in _M. smegmatis_. 

Cells harboring pNHEJ-Cas12a-_recX_ (or pNHEJ-Cas9Sth1-_recX_) were grown in 4 ml of 7H9 medium supplemented with 0.05% Tween 80, 0.2% glycerol, and 25 μg/ml kanamycin. One or two milliliters of starter culture was used to inoculate 100 ml complete 7H9 broth in a 250-ml flask, which was incubated at 37°C overnight. Competent _M. smegmatis_ cells were prepared as previously described (59). About 300 ng of the crRNA-expressing plasmid was mixed with the competent cells. Electroporation was performed with the following settings: 2.5 kV, 25 μF, and 1,000-Ω resistance. After electroporation, 1 ml of 7H9 broth was added to the cells, which were then immediately incubated for 4 h at 30°C. Next, the cultures were plated on 7H10 agar supplemented with the appropriate antibiotics and 50 ng/ml ATc. When targeting the _gfp_ gene, the editing efficiency was calculated as the frequency of GFP-negative (white) transformants. Each time, at least 24 GFP-negative colonies were picked for PCR and sequencing analysis. To cure the helper plasmids, a single colony was picked and grown to saturation in 7H9 medium at 37°C, followed by plating on 7H10 plates. The colonies from these plates were streaked to screen for loss of antibiotic resistance, and more than 70% of the colonies had lost the two helper plasmids in most cases.

### Genome editing in _M. marinum_. 

Cells harboring pMV261-Cas12a were grown in 4 ml of 7H9 medium supplemented with 0.05% Tween 80, 0.2% glycerol, OADC, and 25 μg/ml kanamycin. One or two milliliters of starter culture was used to inoculate 100 ml complete 7H9 broth in a 250-ml flask, which was incubated at 30°C for 3 to 5 days. Competent _M. marinum_ cells were prepared as previously described (60). Electroporation of _M. marinum_ was performed in a similar manner as for _M. smegmatis_. After electroporation, the cells were cultured in 1 ml of 7H9 broth supplemented with OADC and incubated overnight at 30°C. Next, the cultures were plated on 7H10 agar supplemented with OADC, the appropriate antibiotics, and 50 ng/ml ATc. The plates were incubated for 10 to 15 days at 30°C, after which time transformants were picked for PCR and sequencing analysis. Target-specific primers were designed to amplify sequences at least 1,000 bp upstream and downstream from the chromosomal sequences flanking the cleavage sites. The PCR products were analyzed via agarose gel electrophoresis, and the colonies with smaller or no PCR products were regarded as mutants. The PCR products amplified from the transformants with sizes similar to that of the wild-type strain were further analyzed via sequencing. The editing efficiency was calculated as the ratio of the number of edited events to the total number of colonies analyzed by PCR and sequencing. To cure the helper plasmids, a single colony was picked and grown to saturation in 7H9 medium supplemented with OADC at 30°C, followed by plating the cells on 7H10 plates supplemented with OADC. The colonies from these plates were streaked to screen for loss of antibiotic resistance, and more than 50% of the colonies had lost the two helper plasmids in most cases.

### Genome editing in _M. tuberculosis_. 

Cells harboring pNHEJ-_recX_-_sacB_ (or pNHEJ-_recA_mu-_sacB_) were grown in 10 ml of 7H9 medium supplemented with 0.05% Tween 80, 0.2% glycerol, OADC, and 25 μg/ml kanamycin. One or two milliliters of starter culture was used to inoculate 100 ml complete 7H9 broth in a roller bottle, which was incubated at 37°C for 5 to 7 days. At an optical density at 600 nm (OD600) of ∼0.8, 10 ml of 15% sterilized glycine stock solution was added, yielding a final concentration of 1.5%, and the incubation continued at 37°C with rolling for an additional 20 to 24 h. Competent _M. bovis_ BCG and _M. tuberculosis_ cells were prepared as previously described (61). Electroporation of _M. bovis_ BCG and _M. tuberculosis_ was performed similarly to that of _M. marinum_ and _M. smegmatis_ with the following modifications. After electroporation, the cells were cultured in 1 ml of 7H9 broth supplemented with OADC and incubated for 2 days at 37°C to allow cells to grow at high density, mimicking the stationary-phase environment. Next, the cultures were plated on 7H10 agar supplemented with OADC, the appropriate antibiotics, and 50 ng/ml ATc. The plates were incubated for 20 to 30 days at 37°C, and transformants were then picked for PCR and sequencing analysis. To cure the helper plasmids, a single colony was picked and grown to saturation in 7H9 medium supplemented with OADC and 5 μg/ml kanamycin at 37°C. The cells were then diluted 1:100 in 1 ml of 7H9 medium supplemented with OADC and grown for 5 days. The cultures were diluted and plated on 7H10 plates supplemented with OADC and 2% sucrose. The colonies from these plates were streaked to screen for loss of antibiotic resistance, and more than 70% of the colonies had lost the two helper plasmids in most cases.

For the sequential mutation of four genes in _M. tuberculosis_, the _Rv3408_ mutant was first constructed as described above using a Zeor sgRNA-expressing plasmid. Next, a verified colony was picked to prepare competent cells, which were then transformed with a Hygr sgRNA-expressing plasmid targeting _Rv0059_. The transformants obtained were verified to have the _Rv0059_ mutation and loss of Zeocin resistance. A verified colony was picked to prepare competent cells, which were then transformed with a Zeor plasmid expressing double sgRNAs targeting _Rv2494_ and _Rv2596_ to simultaneously generate the double mutations, generating an _M. tuberculosis_ strain with mutations in four genes.

### Genome editing in _E. coli_. 

Genome editing in _E. coli_ was performed as described previously (23). Briefly, the competent _E. coli_ cells harboring the appropriate plasmids were transformed with control or _lacZ_ targeting the sgRNA plasmid and then plated on the appropriate selective LB plate supplemented with X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) (40 μg/ml) and IPTG (isopropyl-β-d-thiogalactopyranoside) (100 μM). Editing efficiency was calculated as the ratio of white colonies on the X-Gal plate to the total number of transformants. Normalized editing efficiency was calculated as the editing efficiency × (total CFU obtained with _lacZ_-targeting sgRNA/total CFU obtained with control sgRNA).

### Whole-genome sequencing. 

Edited strains and strain H37Ra harboring the helper plasmids pNHEJ-_recX_ or pNHEJ-_recA_mu were incubated at 37°C until they reached an OD600 of 0.6 to 0.8. _M. marinum_ and _M. tuberculosis_ chromosomal DNA was extracted as previously described (62) and then sonicated into fragments of less than 500 bp. The fragments were treated with End Prep enzyme mixture for end repair, 5′-end phosphorylation, and dA tailing in one reaction, followed by a T-A ligation reaction to add adaptors to both ends. Size selection of the adaptor-ligated DNA was then performed using the AxyPrep Mag PCR clean-up kit (Axygen), and fragments of approximately 410 bp (with an approximate insert size of 350 bp) were recovered. Each sample was then amplified via PCR for eight cycles using the P5 and P7 primers, both of which carry sequences that can anneal with the flow cell to perform bridge PCR. The P7 primer also carries a 6-base index that allows multiplexing. The PCR products were cleaned up using the AxyPrep Mag PCR clean-up kit (Axygen), validated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), and quantified with a Qubit2.0 fluorometer (Invitrogen, Carlsbad, CA, USA). Sequencing was carried out using a 2 × 150-bp read length, and approximately 500-fold coverage for the genome size was expected.

### Construction of the CRISPR knockout library. 

A total of 88 sgRNA-expressing plasmids targeting 44 toxin genes were constructed individually. Purified pooled plasmids were transformed into _M. tuberculosis_ H37Ra cells carrying pNHEJ-_recX_-_sacB_. The resulting transformants were first picked for analysis of the transformed sgRNAs and then for verification of the genome editing via PCR and sequencing analysis.

### Data availability. 

The data that support the findings of this study are available from the corresponding authors upon request. Short-read data in this study have been deposited at the NCBI Sequence Read Archive (SRA) with the accession number PRJNA559662.

Regulation of CRISPR-Cas9 functions in vivo is conducive to developing precise therapeutic genome editing. Here, we report a CRISPR-Cas9 prodrug nanosystem (termed NanoProCas9), which combines the targeted delivery and the conditional activation of CRISPR-Cas9 for the precision therapy of inflammatory bowel disease. NanoProCas9 is composed of (i) cationic poly(β-amino ester) (PBAE) capable of complexing plasmid DNA encoding destabilized Cas9 (dsCas9) nuclease, (ii) a layer of biomimetic cell membrane coated on PBAE/plasmid nanocomplexes for the targeted delivery of PBAE/dsCas9 complexes, and (iii) the stimuli-responsive precursory molecules anchored on the exofacial membrane. The systemic administration of NanoProCas9 enables the targeted delivery of dsCas9 plasmid into inflammatory lesions, where the precursory small molecule can be activated by ROS signals to stabilize expressed dsCas9, thereby activating Cas9 function for inflammatory genome editing. The proposed “genome-editing prodrug” presents a proof-of-concept example to precisely regulate CRISPR-Cas9 functions by virtue of particular pathological stimuli in vivo.

Genome-editing prodrug: Targeted delivery and conditional stabilization of CRISPR-Cas9 for precision therapy of inflammatory disease

### Materials

All reagents used in the experiments were purchased from commercial sources without further purification. Anhydrous dichloromethane (DCM), anhydrous _N_,_N_-dimethylformamide (DMF), HBr [48% (w/w) in H2O], DCC, 4-dimethylaminopyridine (DMAP), rhodamine B, dimethyl sulfoxide (DMSO), and TMP were purchased from Energy Chemical Co. Ltd. (Shanghai, China). Branched polyethyleneimine [PEI25K; weight-average molecular weight (_M_w): 25 kDa] was supplied by Meilunbio Co. Ltd. (Dalian, China). Dulbecco’s modified Eagle’s medium, RPMI 1640, and FBS were purchased from Sigma-Aldrich (USA). Lipofectamine 2000 and Lipofectamine 3000 transfection reagents were purchased from Thermo Fisher Scientific (Germany). The transfection reagent jetPEI was supplied by PolyPlus. The CCK-8 and LDH release assay kit were obtained from Beyotime Co. Ltd. (Shanghai, China). The dialysis bag [molecular weight cutoff (MWCO): 1000 Da] was obtained from Yuanye Bio-Technology Co. Ltd. (Shanghai, China). T7E1 enzyme was purchased from New England Biolabs (USA). Ultrapure water was obtained from a Milli-Q system. The plasmid encoding CMV-DHFR-Cas9-DHFR-U6-sgRNA (no. 85447) was supplied by Addgene.org, which was examined by Sanger sequencing and enzyme digestion. CMVIE94-3XFLAG-NLS-Cas9-NLS-P2A-EGFP (CMV-Cas9-P2A-EGFP) and CMV-3XFLAG-NLS-Cas9-NLS (wild-type) were constructed in our laboratory. Target sgRNA (sg_PHD2_) was designed by online tools (http://crispr.mit.edu/ and http://chopchop.cbu.uib.no/). All primers used in this work were listed in tables S1 to S5. The plasmids used in this work and corresponding nanocomplex information were listed in table S6 and in the “Plasmid information” section in Supplementary Materials. Primary antibodies used in this project included the following: Anti–TNF-α (1:1000) antibody was obtained from Beyotime (Shanghai, China). Anti-PHD2 (1:1000) antibody and cell/tissue lysis buffer [radioimmunoprecipitation assay (RIPA) buffer] were obtained from Solarbio Science and Technology (Beijing, China). Anti-FLAG antibody was obtained from HuaAn Biotechnology (HUABIO, Hangzhou, China). Anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibody was obtained from Abcam (Shanghai, China). All enzyme-linked immunosorbent assay (ELISA) kits used in this project were supplied by Multisciences (Hangzhou, China). Cationic PBAE was synthesized according to the previous literature (scheme S1 and fig. S1) (_16_, _17_).

### Characterization

The 1H NMR spectra and heteronuclear singular quantum correlation spectrum of PBAE were carried out on a Bruker 500-MHz NMR spectrometer and were reported as chemical shifts (δ) in ppm relative to tetramethylsilane (δ = 0). Proton spin multiplicities are reported as a singlet (s), doublet (d), triplet (t), quartet (q), and quintet (quint), with coupling constants (J) given in hertz, or multiplet (m). Mass spectra were recorded on a Shimadzu liquid chromatography–mass spectrometry (LC-MS) mass spectrometer (LC-MS 2020). TEM was carried out on a TEM (HT7700, Hitachi, Japan). Sizes and zeta potentials of the nanoparticles were characterized by Malvern Nano ZS90. Mass analysis of OE-PEG, BAM-TK-COOH, and BAM-TK-TMP was performed on MALDI-TOF (Ultraflextreme, Bruker, Germany). The molecular weight analysis of PBAE was performed on a Waters 1525/2414 GPC system. Confocal microscopy was performed on LSM-880 (Carl Zeiss, Germany). The DiI intensity was evaluated with an in vivo imaging system (IVIS Spectrum, PerkinElmer).

### Synthesis of 4-[((2,4-diaminopyrimidin- 5-yl) methyl)]-2,6-dimethoxyphenol (TMP-OH)

TMP-OH was synthesized according to the previous report (_33_). Briefly, TMP (1.00 g, 3.4 mmol) was dissolved in HBr (12.5 ml, 48% in H2O) and stirred at 95°C. After 20 min, the mixture was cooled down to room temperature and 2.97 ml of 50% (w/w) NaOH aqueous was added dropwise during stirring. After that, the solution was kept at 4°C overnight. The white precipitate was filtered and washed with double-distilled water (ddH2O). Residues were redissolved in boiling water, and 1 N NaOH was added to adjust pH to ~7.0 for recrystallization. After being cooled down at 4°C for a while, a pink solid, TMP-OH, was precipitated and washed by water (630 mg, 66%). 1H NMR (DMSO-_d6_) δ 8.06 (s, -OH), 7.45 (s, 1H), 6.48 (s, 2H), 5.99 (s, -NH2), 5.63 (s, -NH2), 3.71 (s, 6H), and 3.47 (s, 2H). MS mass/charge ratio (_m/z_) found: 277.15, calculated: 277.12 for C13H16N4O3 [M+H]+.

### Synthesis of polyethylene glycol monooleyl ether-thioketal (BAM-TK-COOH)

To a solution of polyethylene glycol monooleyl ether (_n_ = ~50, 250 mg, 0.1 mmol), DMAP (12 mg, 0.1 mmol) and thioketal (252 mg, 1 mmol) in 20 ml of anhydrous DCM at 0°C were added dropwise with 10 ml of DCC (206 mg, 1 mmol)/DCM solution. After completion of addition of DCC, the reaction mixture was transferred to room temperature and stirred for 72 hours under a nitrogen atmosphere. After that, the insoluble by-product was filtered and the solvents were removed by rotary evaporation. The residue was dissolved in water and dialyzed (MWCO, 1000 Da) against water/methanol (1:1, v/v) for the first 24 hours and water for 48 hours. The product, BAM-TK, was collected and lyophilized for further reaction (193 mg, 70%).

### Synthesis of polyethylene glycol monooleyl ether-thioketal (BAM-TK-TMP)

TMP-OH (19 mg, 0.07 mmol) was added to a solution of BAM-TK (190 mg, 0.07 mmol) and DMAP (2 mg, 0.02 mmol) in 20 ml of anhydrous DMF. After stirring for 10 min under a nitrogen atmosphere, DCC (29 mg, 0.14 mmol), which was dissolved in 5 ml of DMF, was added dropwise into reaction mixture. After addition, the mixture was stirred at 30°C for 72 hours. The solvent of crude product was removed by rotary evaporation, and the product was redissolved in DCM. The by-product was filtered, and the filtrate was collected. After removal of DCM by rotary evaporation, the solid was redissolved in methanol. The product, BAM-TK-TMP, was obtained after dialysis against methanol for 24 hours and water for 48 hours (MWCO, 1000 Da) and further lyophilization.

### Deep sequencing assay

The schematic illustration of deep sequencing assay was shown in scheme. S3. First, the off-target loci were evaluated and designed at CasOFFinder website (www.rgenome.net/cas-offinder/). Subsequently, the fragments were amplified with corresponding primers, termed first PCR product. After purification by PCR/Gel Extraction and Purification kits (Vazyme Biotech Co., Ltd), the first PCR product was further amplified to obtain PCR fragments less than 250 base pairs (bp) containing corresponding gene loci. Then, the product, termed second PCR product, was further extracted and purified. After that, the second PCR product was amplified with primers containing index sequence and then purified by PCR/Gel Extraction and Purification kits. The products were sent to company for sequencing. The results were analyzed by CRISPResso2 according to the instruction (_51_).

### Statistical analysis

All data and figures in this paper were analyzed and plotted by GraphPad Prism 8.0. The obtained data are expressed as means ± SD. Biological replicates were used in all experiments unless otherwise stated. The statistical significance was analyzed using one-way analysis of variance (ANOVA) with a Tukey post hoc test. _P_ value less than 0.05 was considered significant (*_P_ < 0.05, **_P_ < 0.01, \*\**_P_ < 0.001, and \*\*\**_P_ < 0.0001). ns means no significance. N.D. refers to not detectable.

CRISPR–Cas systems require discriminating self from non-self DNA during adaptation and interference. Yet, multiple cases have been reported of bacteria containing self-targeting spacers (STS), i.e. CRISPR spacers targeting protospacers on the same genome. STS has been suggested to reflect potential auto-immunity as an unwanted side effect of CRISPR–Cas defense, or a regulatory mechanism for gene expression. Here we investigated the incidence, distribution, and evasion of STS in over 100 000 bacterial genomes. We found STS in all CRISPR–Cas types and in one fifth of all CRISPR-carrying bacteria. Notably, up to 40% of I-B and I-F CRISPR–Cas systems contained STS. We observed that STS-containing genomes almost always carry a prophage and that STS map to prophage regions in more than half of the cases. Despite carrying STS, genetic deterioration of CRISPR–Cas systems appears to be rare, suggesting a level of escape from the potentially deleterious effects of STS by other mechanisms such as anti-CRISPR proteins and CRISPR target mutations. We propose a scenario where it is common to acquire an STS against a prophage, and this may trigger more extensive STS buildup by primed spacer acquisition in type I systems, without detrimental autoimmunity effects as mechanisms of auto-immunity evasion create tolerance to STS-targeted prophages.

Prophages are associated with extensive CRISPR–Cas auto-immunity

### Detection of CRISPR arrays

The complete genome collection of the PATRIC database (19) (a total of 110 334 genomes) was used in our analysis. CRISPR arrays were predicted for each genome using CRISPRDetect 2.2.1 (20) with a quality score cut-off of 3.

### Detection of self-targeting spacers

All spacers were blasted (blastn-short option, DUST disabled, _e_-value cut-off of 1, gap open, and gap extend penalty of 10) against the source genome. The blastn results were filtered for a minimum identity higher than 90% with the target. Any hit on the genome was considered a self-target, except for those within all of the predicted CRISPR arrays, including arrays identified with a CRISPRDetect quality score <3. Hits closer than 500 bp from each end of the predicted arrays were also ignored to avoid considering spacers from the array that were possibly not identified by CRISPRDetect. Spacers with flanking repeats of identity score lower than 75% to each other were discarded as they may have been erroneously identified as spacers. Of these, only spacers smaller than 70 bp and a repeat size between 24 and 50 bp were retained in the dataset. Finally, STS from CRISPR arrays of two or fewer spacers were excluded, except when the associated repeat belonged to a known CRISPR repeat family, as identified by CRISPRDetect. Duplicates were removed by search of similar genomes, contigs and arrays.

### Classification of CRISPR–Cas systems

The CRISPR–Cas systems of STS-containing genomes were classified using MacsyFinder (21) in combination with Prodigal (22), and the CRISPR-type definitions and Hidden Markov Models (HMM) profiles of CRISPRCasFinder (23). The classification of the repeat family of the CRISPR array was obtained using CRISPRDetect. Genomes carrying two or more CRISPR–Cas types were labeled as ‘mixed’, and those having CRISPR–Cas arrays but no _cas_ genes were labeled as ‘no Cas’. Systems which could not be assigned a CRISPR sub-type and which were missing at least one _cas_ gene (but contained no less than one _cas_ gene) were classified as ‘incomplete’. The final classification of each genome can be found in Supplementary Table S1.

### Analysis of the genomic target

The orientation of the arrays was determined by CRISPRDetect using the default parameters of CRISPRDirection. After this, the STS sequence was used for a gapless blastn at the target and to retrieve the PAM downstream or upstream of the STS based on the CRISPRDetect classification (see Supplementary Table S1). The targets were then analyzed for the correct PAM sequence by comparison with the expected PAM for the different CRISPR–Cas types as previously described (11,24,25). The consensus PAM sequences used in this analysis are shown in Supplementary Table S2. Genes of STS-containing genomes were predicted using Prodigal and annotated using Interproscan (26) and Pfam (27) domain prediction. Prophage regions in the genomes were detected using VirSorter (28), and used to identify STS targeting these regions. Transposons were also detected in the genomes using Interproscan (26) (Supplementary Table S3). Targets of the STS with _e_-value <10−5 were grouped by function to identify possibly enriched hits separately for prophage and endogenous regions. Only those hits associated with predicted correct PAMs were subjected to this analysis.

### Distance between self-targeting spacer and prophages

Contigs predicted to contain prophages were extracted and used to create a hit density map based on STS distance to prophage(s).

### Identification of anti-CRISPR proteins

The amino acid sequences of known Acrs (29) were used for similarity search in the STS-containing genomes using BLASTp with an e-value limit of 10−5.

### Statistical analysis

A binomial test was performed on CRISPR arrays of different sizes to test the hypothesis that STS at the leader side of the CRISPR array are more common. Only STS from CRISPR arrays <50 spacers were considered because larger arrays are too scarce to result in a reliable statistical analysis. A chi-squared test was used to determine statistical significance between percentages of populations. Statistical significance was considered for _P_ < 0.05.

### Software

GNU parallel was used to parallelize tool runs and for parsing of output files (30). Biopython package (31) functions were used for specific analysis, such as GFF parser for prodigal files, pairwise2 for removing false positives based on repeat identity, and nt_search for matching of the PAM. All data collected was managed using Python package Pandas (32). Python packages SciPy (33), Matplotlib (34) and Seaborn (35) were used for statistical analysis and visualization.

Clustered regularly interspaced short palindromic repeats (CRISPR), in combination with CRISPR associated (cas) genes, constitute CRISPR-Cas bacterial adaptive immune systems. To generate immunity, these systems acquire short sequences of nucleic acids from foreign invaders and incorporate these into their CRISPR arrays as spacers. This adaptation process is the least characterized step in CRISPR-Cas immunity. Here, we usedPectobacterium atrosepticumto investigate adaptation in Type I-F CRISPR-Cas systems. Pre-existing spacers that matched plasmids stimulated hyperactive primed acquisition and resulted in the incorporation of up to nine new spacers across all three native CRISPR arrays. Endogenous expression of thecasgenes was sufficient, yet required, for priming. The new spacers inhibited conjugation and transformation, and interference was enhanced with increasing numbers of new spacers. We analyzed ∼350 new spacers acquired in priming events and identified a 5′-protospacer-GG-3′ protospacer adjacent motif. In contrast to priming in Type I-E systems, new spacers matched either plasmid strand and a biased distribution, including clustering near the primed protospacer, suggested a bi-directional translocation model for the Cas1:Cas2–3 adaptation machinery. Taken together these results indicate priming adaptation occurs in different CRISPR-Cas systems, that it can be highly active in wild-type strains and that the underlying mechanisms vary.

Priming in the Type I-F CRISPR-Cas system triggers strand-independent spacer acquisition, bi-directionally from the primed protospacer

### Bacterial strains and growth conditions

All strains and plasmids used in this study are given in Supplementary Table S1 and details of their construction provided in Supplementary Materials and Methods. _P. atrosepticum_ SCRI1043 (30) was grown at 25°C and _E. coli_ at 37°C in Luria Broth (LB) at 180 rpm or on LB-agar (LBA) plates containing 1.5% (w/v) agar. When required, media were supplemented with the following: ampicillin (Ap; 100 μg/ml), chloramphenicol (Cm; 25 μg/ml), kanamycin (Km; 50 μg/ml), tetracycline (Tc; 10 μg/ ml) and D-glucose (0.2% w/v). Bacterial growth was measured in a Jenway 6300 spectrophotometer at 600 nm (OD600).

### Molecular biology and DNA sequencing

Oligonucleotides were from Invitrogen or IDT and are listed in Supplementary Table S2. All strains and plasmids were confirmed by polymerase chain reaction (PCR) and DNA sequencing was performed at the Allan Wilson Centre, New Zealand. Plasmid DNA was prepared using Zyppy Plasmid Miniprep Kits (Zymo Research). DNA from PCR and agarose gels was purified using the GE Healthcare Illustra GFX PCR DNA and Gel Band Purification Kit. Restriction enzymes and T4 DNA ligase were from Roche or NEB.

### Priming assays

Five millilitres cultures of _P. atrosepticum_ ΔHAI2 with pTRB30 (vector control) or pPF189 were grown overnight without antibiotic selection (Figure ​(Figure1).1). Note that 10 μl were used to inoculate a fresh overnight culture and dilutions were plated onto LBA. This was repeated over 5 days and performed in triplicate. Colonies (100) from each replicate were patched onto LBA ± Km. Km sensitive (KmS) colonies were screened by PCR for new spacers as described later.

  Figure 1.

A pre-existing spacer:protospacer match accelerates Cas-dependent plasmid loss. (**A**) _P. atrosepticum_ contains a Type I-F CRISPR-Cas system composed of three CRISPR arrays (1–3; gray arrows) and an operon of 6 _cas_ genes (colored arrows). CRISPR2 consists of 10 spacers and spacer 6 (from leader proximal end; blue) perfectly matches a protospacer (red) in _eca0560_ in the chromosomal island HAI2, but has a TG PAM variant. (**B**) Schematic of the plasmid loss assays. _P. atrosepticum_ ΔHAI2 carrying pTRB30 (control) or pPF189 (_eca0560_ primed; depicted) plasmids were grown without selection for 5 days and plasmid loss was scored by replica-plating on non-selective (NS) and selective (S) media. (**C**) Plasmid loss of a control plasmid (pTRB30) and the primed plasmid (pPF189) over 5 days when cultured in ΔHAI2 or ΔHAI2Δ_cas_ backgrounds. Data shown are the mean ± SD of three biological replicates.

_P. atrosepticum_ containing plasmids pPF571 (vector control), pPF574 and pPF575 (priming vectors with protospacer 1 from the CRISPR1 array with a mutated PAM in F and R orientations) were grown overnight in 5 ml LB and passaged for 5 days by transfer of 10 μl to 5 ml fresh LB. Additionally, dilutions were plated on LBA + 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG) for mCherry induction. White colonies were screened for CRISPR expansion and sequenced as outlined below.

### CRISPR PCR and sequence analysis

Colonies displaying plasmid loss were screened by colony PCR using primers for CRISPR1 (PF174 and PF175), CRISPR2 (PF176 and PF177) or CRISPR3 (PF178 and PF179). The resulting products were separated on 2% agarose gels, purified and sequenced using PF175, PF177 or PF179 for CRISPR arrays 1, 2 or 3, respectively. Sequences were analyzed using CRISPRFinder (31), spacer sequences were extracted and assembled against target plasmids using Geneious™ and CRISPRTarget (23) to define the protospacer location, target strand and PAM.

### Transformation and conjugation assays

Electrocompetent _P. atrosepticum_ cells were prepared as described previously (32). For transformations, 50 ng of DNA was added to 50 μl of competent cells, incubated on ice for 10 min then electroporated (1 mm electro-cuvettes, 1800 V, capacitance 25 μF and resistance 200 ohms). Bacteria were recovered in 1 ml LB for 2 h at 25°C and then plated on LB containing the appropriate supplements and grown at 25°C. Transformation efficiency was calculated as transformants/ng of DNA and normalized to non-targeted plasmid controls.

For conjugation, the tested plasmids were transformed into _E. coli_ S17–1 λpir. Donor (_E. coli_ S17–1 λpir with tested plasmids) and recipient strains were grown overnight in LB with the appropriate antibiotics. The OD600 was adjusted to 1 and cells washed twice with LB. The donor and recipient strains were mixed (1:1 ratio), 5 μl of the mixture spotted on 0.2 μm filters (Millipore) on LBA and incubated overnight. Cells were resuspended in 2 ml phosphate buffered saline by vortexing the filters and dilution series were plated on LBA (total cells), LBA + Sp (donors) and glucose minimal medium + Km (transconjugants). The efficiency of conjugation was calculated as transconjugants per recipients.

As a novel and robust gene‐editing tool, the Clustered Regularly Interspaced Short Palindromic Repeats CRISPR‐associated protein 9 (CRISPR‐Cas9) system has revolutionized gene therapy. Plasmid vector delivery is the most commonly used method for integrating the CRISPR‐Cas9 system into cells. However, such foreign cytosolic DNAs trigger an innate immune response (IIR) within cells, which can hinder gene editing by inhibiting transgene expression. Although some small molecules have been shown to avoid the action of IIR on plasmids, they only work on a single target and may also affect cell viability. A genetic approach that works at a comprehensive level for manipulating IIR is still lacking. Here, we designed and constructed several artificial nucleic acid molecules (ANAMs), which are combinations of aptamers binding to two key players of IIR (β‐catenin and NF‐κB). ANAMs strongly inhibited the IIR in cells, thus improving transgene expression. We also used ANAMs to improve the gene‐editing efficiency of the CRISPR‐Cas9 system and its derivatives, thus enhancing the apoptosis of cancer cells induced by CRISPR‐Cas9. ANAMs can be valuable tools for improving transgene expression and gene editing in mammalian cells.

Improving transgene expression and CRISPR‐Cas9 efficiency with molecular engineering‐based molecules

### 4.1. Cell culture and cell transfection

HEK293T, 5637, SW80, and Hela cell lines were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA). HEK293T, SW780, and Hela cells were maintained in Dulbecco's Modified Essential Medium, while 5637 cells were maintained in 1640 medium. All media were supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA) and maintained in 5% CO2 at 37°C. For transient transfection assays, the cells were seeded in six‐well plates the day before transfection using Lipofectamine‐3000 (Invitrogen). At 48 h post‐transfection, cells were harvested for follow‐up assays.

The human iPS cell line was purchased from ATCC and cultured in mTeSR1 (STEMCELL Technologies) in Geltrex (Gibco)‐coated six‐well plates. Cells were transfected with plasmids using Lipofectamine Stem Reagent (Invitrogen) and were harvested for follow‐up assays at 48 h post‐transfection.

### 4.2. Plasmid construction

All ANAMs were constructed by chemical synthesis based on the designed sequence. The ANAM sequences are listed in Table S1. The U6 promoter was used to drive the expression of ANAMs, and the U6‐ANAMs were incorporated into a pcDNA3.1 plasmid vector. The original plasmids (Addgene) of CRISPR‐Cas9, CRISPR‐dCas9‐vp64, and CRISPR‐dCas9‐Krab used in this study were previously reported. 39 The bpcDNA3.1 sequence was designed based on the sequence of pcDNA3.1 after deleting the resistance gene and marker protein‐coding gene from its backbone and was then chemically synthesized. β‐Catenin‐pcDNA3.1, NF‐κB‐pcDNA3.1, and CD23‐pcDNA3.1 plasmids were purchased from Beijing SyngenTech Co., Ltd.

### 4.3. Generation of the stable transgenic cell lines

The 293t and 5637 cell lines were transfected with pcDNA3.1/GFP/Neo plasmids using Lipofectamine 3000 (Invitrogen) and treated with G418 to select the 293t‐GFP and 5637‐GFP stable transgenic cell lines. Also, the 293t and 5637 cell lines were transfected with the AON promoter‐GFP expression pcDNA3.1 plasmid to generate the 293t‐AON and 5637‐AON stable transgenic cell lines. The stable transgenic cell lines were obtained by G418 resistance screening.

### 4.4. RNA extraction and real‐time qPCR

The total RNAs of transfected cells were extracted using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. The RevertAid First Strand cDNA Synthesis Kit (Fermentas, Hanover, MD, USA) was used to synthesize cDNAs from total RNAs. The All‐in‐One qPCR Mix (GeneCopoiea, Rockville, MD, USA) was used to perform the real‐time qPCR reactions on an ABI PRISM 7000 Fluorescent Quantitative PCR System (Applied Biosystems, Foster City, CA, USA). The PCR cycling parameters were as follows: 95°C for 15 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 45 s. The primer sequences are listed in Table S2.

### 4.5. Dual‐luciferase reporter assay

To measure the transcriptional activity of β‐catenin and NF‐κB, a dual‐luciferase reporter was constructed using β‐catenin or NF‐κB responsive elements. The β‐catenin reporter contained Tcf‐binding elements and the minimal promoter, which were inserted upstream of the firefly luciferase gene on the dual‐reporter vector. Similarly, the NF‐κB reporter contained multiple binding sites for NF‐κB and the minimal promoter. Cells were seeded in six‐well plates (5 × 10 5 per well) and co‐transfected with the β‐catenin or NF‐κB dual‐luciferase reporter vector and the ANAM expression vector. Luciferase activity was measured using the dual‐luciferase assay system (Promega, Madison, WI, USA) according to the manufacturer's instructions at 48 h after transfection. The firefly luciferase activity was normalized to the Renilla luciferase activity.

### 4.6. Surface plasmon resonance assay

The affinity of the constructed ANAMs for β‐catenin or NF‐κB proteins was measured by surface plasmon resonance using a Biacore X100 instrument (GE Healthcare, Uppsala, Sweden). Briefly, the CM5 sensor chip (GE Healthcare) was preequilibrated with running buffer prior to the immobilization of ligands onto the chip surface and activated with 0.05 M _N_‐hydroxysuccinimide (NHS; GE Healthcare) and 0.2 M 1‐ethyl‐3‐(3‐dimethylaminopropyl) carbodiimide (EDC; GE Healthcare). Each protein was then injected into the flow cells of the sensor chip, and amine coupling chemistry was used for covalently attaching ligands to the sensor chip surface. After immobilization of the ligand, the chip surface was deactivated with 1 M ethanolamine hydrochloride to block the remaining unreacted groups. DNA template oligonucleotides for ANAMs were transcribed into RNA using the MEGA‐shortscript T7 kit (Life Technologies). Then various concentrations of the ANAMs were injected over the sensor surface for 1.5 min at 5 μL/min, and subsequently analyzed for equilibrium binding properties.

### 4.7. ELISA assay

The cells were seeded in 6‐well plates (5 × 105 cells/well) and transfected using the firefly luciferase reporter system. After 36 h, the medium was removed, and the cells were lysed with lysis buffer (Analytical Luminescence Laboratories, Mansfield, MA, USA). The level of firefly luciferase activity was measured by the Firefly Luciferase Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer's protocol.

### 4.8. Western blotting

Cells were washed with phosphate‐buffered saline (PBS) and lysed in the RIPA buffer (Beijing Solarbio Science and Technology Co.). The protein concentration was determined using a BCA kit (Beijing Solarbio Science and Technology Co., Ltd.). Equal amounts of whole protein extracts were electrophoresed onto SDS–polyacrylamide gels and then transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA). The samples were blocked in 5% dry milk and incubated overnight with the primary antibodies against BCL2 (ab32124; 1:1000) and BAX (ab32503; 1:10 000). The next day, samples were incubated with the horseradish peroxidase‐conjugated secondary antibody (Amersham, Piscataway, NJ) and immunoblots were developed with Super Signal chemiluminescence reagents (Pierce Chemical Co.).

### 4.9. Flow cytometry

To determine fluorescent protein expression, the cells were suspended in PBS and analyzed by flow cytometry (BD Biosciences, San Jose, CA, USA). We also used flow cytometry to determine the level of apoptosis. The cells were resuspended and treated with fluorescein isothiocyanate (FITC) and propidium iodide (PI) dye (Transgene, Beijing, China) according to the manufacturer's instructions. Data were analyzed using FlowJo software (TreeStar, Ashland, OR, USA).

### 4.10. Detection of GFP expression

The transfected cells were cultured in the normal growth medium, and the GFP expression was visualized using fluorescent microscopy (MicroPublisher 3.3 RTV; Olympus, Tokyo, Japan). The images were captured using the auto‐exposure mode.

### 4.11. Determination of NHEJ‐mediated indel mutations

Human iPS cells were harvested at 48 h post‐transfection, and the genomic DNA was extracted using the QuickExtract DNA Extraction system (Epicentre). Subsequently, PCR was performed to amplify the target regions using the genomic DNA as a template. The PCR products were purified using the ISOLATE II PCR and Gel Kit (Bioline) and subjected to Sanger sequencing. Total NHEJ frequencies were determined by decomposition of the sequencing chromatogram using the TIDE software program (https://tide-calculator.nki.nl/). Depicted values were generated from TIDER analyses with _R_ 2 values > 0.9 and _P_ < .001.

### 4.12. Statistical analyses

Data were summarized as the mean ± SEM. Significance tests were performed using SPSS statistical software for windows, version 21.0 (SPSS, Chicago, IL, USA). Statistical significance was determined using Student's _t_‐test or analysis of variance and a value of _P_ < .05 was considered to be statistically significant.

Go to:


A powerful contributor to prokaryotic evolution is horizontal gene transfer (HGT) through transformation, conjugation, and transduction, which can be advantageous, neutral, or detrimental to fitness. Bacteria and archaea control HGT and phage infection through CRISPR-Cas (clustered regularly interspaced short palindromic repeats–CRISPR-associated proteins) adaptive immunity. Although the benefits of resisting phage infection are evident, this can come at a cost of inhibiting the acquisition of other beneficial genes through HGT. Despite the ability of CRISPR-Cas to limit HGT through conjugation and transformation, its role in transduction is largely overlooked. Transduction is the phage-mediated transfer of bacterial DNA between cells and arguably has the greatest impact on HGT. We demonstrate that inPectobacterium atrosepticum, CRISPR-Cas can inhibit the transduction of plasmids and chromosomal loci. In addition, we detected phage-mediated transfer of a large plant pathogenicity genomic island and show that CRISPR-Cas can inhibit its transduction. Despite these inhibitory effects of CRISPR-Cas on transduction, its more common role in phage resistance promotes rather than diminishes HGT via transduction by protecting bacteria from phage infection. This protective effect can also increase transduction of phage-sensitive members of mixed populations. CRISPR-Cas systems themselves display evidence of HGT, but little is known about their lateral dissemination between bacteria and whether transduction can contribute. We show that, through transduction, bacteria can acquire an entire chromosomal CRISPR-Cas system, includingcasgenes and phage-targeting spacers. We propose that the positive effect of CRISPR-Cas phage immunity on enhancing transduction surpasses the rarer cases where gene flow by transduction is restricted.

CRISPR-Cas-Mediated Phage Resistance Enhances Horizontal Gene Transfer by Transduction

### Bacterial strains, plasmids, and growth conditions. 

Bacterial strains and plasmids used in this study are given in Table S1 in the supplemental material. _P. atrosepticum_ SCRI1043 (49) was grown at 25°C and _E. coli_ at 37°C in lysogeny broth (LB) at 180 rpm or on LB agar (LBA) plates containing 1.5% (wt vol−1) agar. When required, media were supplemented with chloramphenicol (Cm; 25 µg ml−1) or kanamycin (Km; 50 µg ml−1). Bacterial growth was measured in a Jenway 6300 spectrophotometer at 600-nm optical density (OD600).

### Phage lysate preparation and titration. 

The transducing phages, φTE (31) (genome size of ~142 kb) and φM1 (32, 40), were stored in phage buffer (10 mM Tris-HCl [pH 7.4], 10 mM MgSO4, 0.01% [wt vol−1] gelatin). Lysates were made by serially diluting phages in phage buffer, adding the mixture to 100 µl of a mixture consisting of _P. atrosepticum_ culture (pregrown in 5-ml LB overnight) and 4 ml top LBA (0.35% [φTE] and 0.5% [φM1] agar), and pouring the result onto LBA plates. Plates were incubated at 25°C overnight, plaques were counted, and the titer was determined. Top agar from plates with almost confluent lysis was harvested with 3 ml of phage buffer, subjected to vortex mixing with 500 µl chloroform (saturated with NaHCO3) for approximately 2 min, and centrifuged at 2,219 × _g_ for 20 min at 4°C. The supernatant was collected, 100 µl of chloroform was added, and lysates were stored at 4°C. Titers of phages were determined as described above, typically resulting in high-titer stocks (5 × 1010 to 4 × 1011 PFU ml−1).

### Transduction assays. 

Duplicate 6-ml cultures of recipient strains were grown overnight and combined. The cultures were diluted to an OD600 of 2, and 10 ml (total, 1 × 1010 CFU) was pelleted and resuspended in 1 ml LB. Phage lysates were adjusted to 1 × 1011 PFU ml−1, and 100 µl (1 × 1010 PFU) was added at a multiplicity of infection (MOI) of 1. Transductions were incubated statically for 15 min at 25°C, and then 9 ml of LB (25°C) was added and the tubes were shaken for 45 min at 90 rpm on a slight angle at 25°C. Cells were pelleted at 2,219 × _g_ for 9 min at room temperature, the supernatant was removed, and the pellet was resuspended in 10 ml LB. This step was repeated three times to remove excess phages, and the resulting material was finally resuspended in 1 ml LB. A 100-µl sample was plated onto LBA with the appropriate antibiotics, and the rest was pelleted and plated onto the same medium. Plates were incubated at 25°C for up to 5 days, and transductants were counted. Transduction efficiency was calculated as the number of transductants per PFU. Control samples of phage lysate and recipients were plated on the same antibiotics to check for contamination and spontaneous resistance, respectively, and no colonies were detected in any experiment. For infectivity controls, φTE titers were calculated for all lysates on their respective recipient strains to rule out differences in infection that might influence the determination of transduction efficiency (e.g., resulting from a receptor mutation).

### Plasmid transduction. 

_P. atrosepticum_ Δcas (Cmr; strain PCF79 [50]) was made electrocompetent as described previously (36) and transformed with purified pTRB30 and pPF189 plasmids. φTE lysates were prepared on PCF79 transformed with pTRB30 and on PCF79 transformed with pPF189. The lysates were used to transduce the ΔHAI2, PIM06, and PIM17 strains. The CRISPR array spacer content of the PIM strains used in this study was determined by colony PCR and sequencing performed with primers for CRISPR1 (PF174 and PF175), CRISPR2 (PF176 and PF177), or CRISPR3 (PF178 and PF179) as described previously (30). All oligonucleotides used in this study are listed in Table S2. Plasmid transduction was verified by antibiotic resistance (gain of Kmr) and by PCR for the plasmid by using primers PF209 and PF210 (see Fig. S1A and B in the supplemental material). An infectivity control verified that all recipients had the same φTE sensitivity (Fig. S1C). Colonies were also checked for Cm sensitivity, and the results indicated that the colonies were not the original PCF79 strains used for lysate production. Mock lysates (containing no phages) were harvested from strain PCF79 containing either pTRB30 or pPF189 as described earlier but with phage buffer and no phage in the overlays. Mock lysates were used in transductions and did not facilitate plasmid transduction.

#### TABLE S2 

Oligonucleotides used in this study. Download TABLE S2, DOCX file, 0.01 MB.

Copyright © 2018 Watson et al.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

### Transduction of chromosomal loci. 

φTE lysates were prepared on six strains (PCF83 to PCF88) and used in transduction assays with strains ΔHAI2, PIM18, PIM28, and PIM86 as recipients with selection performed on Km (to detect Kmr transfer) or Cm (to detect Cmr control transfer). Phage lysate and recipient controls were also plated as described for the transduction assay. Representative transductants (where obtained) were patched onto LBA with Km and LBA with Cm. Putative transductants were verified by PCR for each marked locus with PF1212 (binds to marked insertion) in combination with the following primers: PF1575 (_eca0128_), PF1573 (_eca0449_), PF1457 (_eca1388_), PF1577 (_eca1657_), PF1459 (_eca3296_), and PF1460 (_eca3672_) (Fig. S2C). To verify the transduction of the _cat_ gene, primers PF432 and PF433 were used (Fig. S2D). As a control transduction, φTE lysates were prepared using the wild-type _P. atrosepticum_ strain (i.e., resulting in no marked transducing particles). When this was used in control transductions, no transductants (Kmr) were obtained.

### Transduction of HAI2. 

To check HAI2 transfer, lysates of φTE were prepared on three strains (PCF89 to PCF91) and used in transduction assays performed with the ΔHAI2 strain or the wild-type strain as the recipient. Since homologous recombination positively affects transduction efficiency, transduction to islandless recipients occurred at a 10-fold-lower frequency (~0.5 × 10−9 transductants/PFU) (Fig. 2B) than was seen with wild-type recipients (~0.5 × 10−8 transductants/PFU). Putative HAI2 transductants were verified by plating on LBA with Km or Cm and by using PCR to amplify features of the various strains. PCR was performed with primer pairs as follows: _cas1_ with PF390 and PF391, _cat_ (Cmr gene) with PF432 and PF433, _attP_ (circularized pHAI2) with PF1225 and PF1226, _attB_ (the HAI2 insertion site) with PF1227 and PF1228, _attL_ (island border regions) with PF1227 and PF1226, _attR_ with PF1225 and PF1228, and, finally, a gene in the island, _eca0560_, with PF1446 and PF1447. To check CRISPR-Cas inhibition of transfer, φTE prepared on PCF90 was used in transduction assays with strains ΔHAI2, PIM06, and PIM31 as recipients.

### Transduction with antiphage strains. 

Transduction assays with antiphage strains were carried out using overnight cultures at an OD600 adjusted to 2 (1 × 109 CFU), and the cultures were resuspended in 1 ml LB in 50-ml tubes. Phages were added at an MOI of 1 (1 × 109 PFU). Assays with φTE were incubated for 15 min statically, followed by 45 min of shaking, before a 100-µl sample and then the remaining amount were plated. Reaction mixtures used for assays with φM1 were incubated for a total of 20 min with shaking, prior to plating onto media with antibiotics.

### Efficiency of plating and efficiency of transduction assays. 

Strains that had acquired φTE- and φM1-targeting spacers were isolated as previously described (51). The value representing the efficiency of plating was defined as the titer of the phage-resistant test strains (PCF188, PCF190, PCF193, PCF254, and PCF256)/the titer of the control strain (SCRI1043). The transducing lysates were prepared on PCF88 and PCF79 with pTRB30 plasmid, and the chromosomal marker and plasmid were transduced into recipients. Efficiency of transduction was determined by calculation of the test transduction efficiency/control (SCRI1043) efficiency.

### Mixed-culture transduction assays. 

Monocultures of the phage-sensitive WT (PCF326) strain and phage-resistant CRISPR (PCF332 [anti-φTE] and PCF400 [anti-φM1]) strains were grown overnight and combined in WT/anti-φ ratios of 100:0, 90:10, 50:50, 10:90, and 0:100, and 1 × 109 cells were used for each assay. Assays were performed with six replicates for both φTE and φM1. Phage lysate was added at an MOI of 1, and cells were shaken for 1 h, in 1 ml LB, before being plated onto LBA with selection. Transductants were patched onto LBA containing Nal or Sm to identify the host strain. Colony forming units (CFUs) were determined by taking initial and final samples (10 µl), plating onto LBA, and patching 100 colonies onto LBA containing Nal or Sm. Total PFU counts were determined by adding an aliquot (10 µl) of culture to LB containing chloroform. PFU fold change was calculated as final PFU/initial PFU. Transduction fold enhancement for WT strains was calculated as follows: (number of transductants/average number of transductants in the 100:0 assay)/proportion of WT cells in the assay.

### Transduction of CRISPR by escape phages. 

Transduction assays were performed as described above (see "Transduction with antiphage strains"). The transduction of CRISPR-Cas into the Δ_cas_ strain was identified by plating transductants onto LBA carrying Km to select for transfer of the chromosomal marker. Transductants were then patched onto LBA with or without Cm to screen for loss of Cmr, indicating that the _cas_ genes had been transferred. PCR screening of CRISPR arrays to detect the transduction of spacers was performed using primers PF174 and PF175 for CRISPR1 and primers PF176 and PF177 for CRISPR2 (Table S2).

### Nested PCR to screen for spacer acquisition. 

Nested PCR was performed using primers PF1730 and PF1732 (round 1) followed by PF1730 and PF1733 (round 2). PCR products from round 1 were purified using an Illustra GFX PCR DNA and gel band purification kit (GE Healthcare) and were used as the round 2 template. To test the level of detection provided by PCR, the strains (PIM20 and ΔHAI2) were grown overnight. The PIM20 strain was serially diluted and combined with the ΔHAI2 strain at appropriate proportions based on OD600 values to create samples with 100 to 1010 PIM20 cells in a pool of 1010 total cells. An aliquot of each sample was used for PCR. Island transduction was carried out as described above (see "Transduction of HAI2"), using a donor with a Kmr marker in _eca0573_ (PCF89). Following transduction, pooled culture was used as the template for round 1 PCR.

RNA-guided nucleases from CRISPR-Cas systems expand opportunities for precise, targeted genome modification. Endogenous CRISPR-Cas systems in many prokaryotes are attractive to circumvent expression, functionality, and unintended activity hurdles posed by heterologous CRISPR-Cas effectors. However, each CRISPR-Cas system recognizes a unique set of protospacer adjacent motifs (PAMs), which requires identification by extensive screening of randomized DNA libraries. This challenge hinders development of endogenous CRISPR-Cas systems, especially those based on multi-protein effectors and in organisms that are slow-growing or have transformation idiosyncrasies. To address this challenge, we present Spacer2PAM, an easy-to-use, easy-to-interpret R package built to predict and guide experimental determination of functional PAM sequences for any CRISPR-Cas system given its corresponding CRISPR array as input. Spacer2PAM can be used in a ‘Quick’ method to generate a single PAM prediction or in a ‘Comprehensive’ method to inform targeted PAM libraries small enough to screen in difficult to transform organisms. We demonstrate Spacer2PAM by predicting PAM sequences for industrially relevant organisms and experimentally identifying seven PAM sequences that mediate interference from the Spacer2PAM-informed PAM library for the type I-B CRISPR-Cas system from _Clostridium autoethanogenum_. We anticipate that Spacer2PAM will facilitate the use of endogenous CRISPR-Cas systems for industrial biotechnology and synthetic biology.

Spacer2PAM: A computational framework to guide experimental determination of functional CRISPR-Cas system PAM sequences

### Prediction of PAM sequences

All CRISPR arrays were retrieved from CRISPRCasdb, part of CRISPR-Cas++, which can be found at https://crisprcas.i2bc.paris-saclay.fr/ (28). Alignment of CRISPR array spacers to genomes was done via BLAST (29) either programmatically using Spacer2PAM or manually through the web interface. The BLASTn algorithm was used and Eukaryotes (taxid:2759) were excluded from the search database. All other manipulations of sequence information and prediction of PAM sequences were completed using Spacer2PAM which is available at https://github.com/grybnicky/Spacer2PAM. Spacer2PAM requires the following dependencies: dplyr, ggplot2, ggseqlogo (30), taxonomizr, HelpersMG, httr, jsonlite, spatstat.utils, readr and seqinr. Prophage prediction uses the Phaster API (31).

Briefly, Spacer2PAM can be used by passing the CRISPR-Cas system's host organism name and a user-defined identifier to setCRISPRInfo, which sets the name of the CRISPR-Cas system and defines file output names. The user then chooses one of two options to input the CRISPR array spacer sequence data. If starting with a FASTA file containing each spacer as an individual sequence, the user may call FASTA2DF to arrange the spacer sequences and other user input information about the CRISPR spacers (array number, length of each array, direction of each array, and the array consensus repeat sequence) into a dataframe which is suitable for downstream analysis with Spacer2PAM. We recommend that the user then call DF2FASTA to generate another FASTA file containing all the spacer sequences. Although the user already supplied a FASTA file with the same sequence information, doing so ensures that the title of each sequence is compatible with downstream Spacer2PAM functions. Alternatively, a user may start with a formatted dataframe containing the headers ‘Strain’, ‘Spacers’, ‘Array.Orientation’, ‘Repeat’, ‘Array’, and ‘Spacer’ and pass it to DF2FASTA to generate a FASTA file containing the spacer sequences with the appropriate labels.

Next, the user then submits the sequences from the FASTA file for alignment to BLAST. This step can either be done programmatically or manually. To send a query to the BLAST server and retrieve the result, call FASTA2Alignment and pass the file location of the properly formatted FASTA file generated from DF2FASTA. While we recommend this method, some CRISPR-Cas systems may contain too many spacers and exceed the query length limit for the NCBI BLAST API. In this instance, FASTA2Alignment will return an error message and encourage the user to visit the BLAST web interface. If using the web interface, select the BLASTn algorithm and to exclude Eukaryotes (taxid:2759). This limits the alignment to relevant organisms and decreases both BLAST and Spacer2PAM computational time. Once the alignment is completed through the BLAST web server, the resulting hit table should be downloaded in .CSV format. The hit table file should then be passed to alignmentCSV2DF to convert it to a dataframe. Performing the alignment programmatically via FASTA2Alignment will generate this dataframe automatically without the need for alingmentCSV2DF.

The resulting dataframe should then be passed to joinSpacerDFandAlignmentDF. This function joins the spacer dataframe with the alignment dataframe, assigning spacer information to each alignment in the hit table. This function also converts the accession number of the alignment to the genus and species name of the organism that encodes the alignment sequence using the taxonomizr package. As the taxonomizr package requires the local download and set up of an SQL database, the user should be prepared to store the 65 GB (at time of writing this) database in a location stably accessible while running joinSpacerDFandAlignmentDF. The resulting joined dataframe is sufficient for PAM prediction by join2PAM, but we recommend calling Submit2Phaster if the user plans to select the prophage prediction option in join2PAM. Submit2Phaster interacts with the PHASTER prophage prediction web server to submit a nonredundant list of accession numbers from the joined dataframe for prophage detection. Depending on the volume of traffic on the PHASTER server, prediction can take minutes to weeks to complete.

Lastly, the joined dataframe is passed to join2PAM. This function is the core of Spacer2PAM and predicts a PAM sequence from the alignments generated by BLAST. Multiple combinations of filter sets can be run sequentially with a single call of join2PAM to enrich alignments to likely protospacers. These filtered alignments are then used to identify the genomes encoding the putative protospacer and the locations of potential PAMs. The algorithm then harvests these potential PAM sequences by taking the sequence upstream and downstream of the alignment based on the position of the alignment to the spacer and the user input flank length. This harvesting procedure accounts for alignments that do not include the ends of the spacer and appropriately adjusts the harvested sequence to ensure PAMs are not shifted. These sequences are then used to calculate significant nucleotide positions and determine frequent nucleotide identities at those positions, generating a PAM prediction. The output of join2PAM is the dataframe ‘collectionFrame’ that summarizes the filtering process and records the upstream and downstream predicted PAMs as well as their associated PAM score.

A template R script is provided in Supplementary File 1 to guide users on how to assemble a PAM prediction workflow using Spacer2PAM.

### Plasmid construction

All individual plasmids and libraries in this work were generated by two-piece Gibson assembly using the GeneArt Seamless Plus kit. Linear backbone was generated by PCR of pMTL82254 using Kapa DNA polymerase Master Mix, purification by gel electrophoresis and extraction with Zymoclean Gel DNA recovery Kit. Linear dsDNA gBlocks ordered from IDT containing the PAM sequence upstream of _C. autoethanogenum_ CRISPR array 1 spacer 19 were used as inserts. Gibson assembly products were transformed into chemically competent One Shot™ MAX Efficiency™ DH10B T1 Phage-Resistant Cells using standard procedures. DNA sequence was confirmed by Illumina MiSeq Sequencing V2 and V3 chemistry. All oligonucleotides and plasmids used in this study can be found in Supplementary Table S1.

### Spacer2PAM-informed PAM prediction screening

Spacer2PAM was applied to the type I-B CRISPR-Cas system of _C. autoethanogenum_ using the ‘Comprehensive’ method. The top 25% of high scoring PAM predictions were used to determine a set of 16 four-nucleotide PAM sequences that are likely to be functional (Supplementary Table S3). The Spacer2PAM-informed, unpooled PAM library constructs were transformed into _E. coli_ HB101 carrying R702 (32) (CA434 (33)) in parallel. Conjugation of library members into _C. autoethanogenum_ DSM 19630, a derivate of type strain DSM 10061, was performed as described earlier (33,34) using erythromycin (250 μg/mL) and clarithromycin (5 μg/mL) for plasmid selection in _E. coli_ and _C. autoethanogenum_, respectively, and trimethoprim (10 μg/mL) as counter selection against _E. coli_ CA434. Optical density of donor _E. coli_ cultures were measured prior to addition to _C. autoethanogenum_ cells. Transconjugant colonies were counted following 4 days of incubation at 37°C under 1.7 × 105 Pa gas (55% CO, 10% N2, 30% CO2, and 5% H2) in gas-tight jars. This was performed in biological triplicate, with 3 separate cultures of donor _E. coli_ conjugated to aliquots of a single _C. autoethanogenum_ culture.

### Randomized PAM library screening

The randomized, pooled PAM library was transformed into NEBExpress® _E. coli_ and then purified by QIAprep Spin Miniprep Kit. An aliquot of this DNA was saved to determine PAM frequencies before exposure to the CRISPR-Cas system. Electroporation into _C. autoethanogenum_ was performed as described previously (35,36). Following recovery, cells were pelleted by centrifugation at 4000 X g for 10 minutes, 9.5 mL of supernatant was discarded, and cells were resuspended in 500 μL YTF. Resuspensions were split by volume and spread on YTF 1.5% agar supplemented with 5 μG/mL clarithromycin, allowed to dry for ∼30 minutes, and incubated at 37°C for 4 days under 1.7 × 105 Pa gas (55% CO, 10% N2, 30% CO2, and 5% H2) in gas-tight jars. 2.5 mL of Luria broth was added to each plate and plates were scraped. Total DNA from the cell suspension was purified using the MasterPure™ Gram Positive DNA Purification Kit. PCR across the PAM and spacer was performed using Kapa DNA polymerase Master Mix followed by purification by gel electrophoresis (1.5% agarose) and extraction with Zymoclean Gel DNA recovery Kit. Extracts were quantified by Quant-iT (Thermo Fisher Scientific), diluted to 1 ng/μL, and prepared for sequencing following the Illumina 16S amplicon protocol starting at the Index PCR step. Ampure XP purified libraries were quantified by Quant-iT and sequenced using MiSeq Reagent Kit V3. Frequency of each PAM was determined by counting the occurrence of each PAM next to a correct protospacer sequence within the read. Briefly, all sequence reads are searched for the presence of the _C. autoethanogenum_ Array 1 spacer 19 sequence and are binned as a forward read, reverse read, or does not contain the spacer. For all reads in the forward and reverse bins, the immediate 4 nucleotides upstream or downstream, respectively, are extracted. The sequences extracted from reverse reads are converted to their reverse complement to be compatible with the sequences extracted from forward reads and the two sets of sequences are combined. The frequency of each 4-nucleotide sequence in the combined list is then counted and recorded. The frequency of each PAM was converted to a relative frequency within the total library and the log2-fold change in relative frequency was calculated from exposure to the CRISPR-Cas system.system.

During the process of prokaryotic CRISPR adaptation, a copy of a segment of foreign deoxyribonucleic acid referred to as protospacer is added to the CRISPR cassette and becomes a spacer. When a protospacer contains a neighboring target interference motif, the specific small CRISPR ribonucleic acid (crRNA) transcribed from expanded CRISPR cassette can protect a prokaryotic cell from virus infection or plasmid transformation and conjugation. We show that inEscherichia coli, a vast majority of plasmid protospacers generate spacers integrated in CRISPR cassette in two opposing orientations, leading to frequent appearance of complementary spacer pairs in a population of cells that underwent CRISPR adaptation. When a protospacer contains a spacer acquisition motif AAG, spacer orientation that generates functional protective crRNA is strongly preferred. All other protospacers give rise to spacers oriented in both ways at comparable frequencies. This phenomenon increases the repertoire of available spacers and should make it more likely that a protective crRNA is formed as a result of CRISPR adaptation.

Pervasive generation of oppositely oriented spacers during CRISPR adaptation

### _E. coli_ strains, plasmids and the primed adaptation experiment

The _E. coli_ KD263 strain is a derivative of BW40119 strain described earlier (28). It contains the _cas3_ gene under the control of the _lac_UV5 promoter and the _casABCDE12_ operon under the _ara_Bp8 promoter control. The KD263 strains harbors a single genetically modified CRISPR cassette with two repeats and a single g8 spacer described earlier (14). KD263 was transformed with a pG8_C1T plasmid, a derivative of the pT7blue cloning vector harboring a 209-bp fragment of the M13 bacteriophage DNA containing the g8 protospacer (28). The protospacer sequence harbors a C to T change at the position of +1 that renders CRISPR interference by the g8 spacer containing crRNA ineffective (14). KD263 cells transformed with pG8_C1T were grown overnight at 37°C in Luria-Bertani (LB) broth supplemented with 100 μg/ml ampicillin. Aliquots of the culture were diluted 200-fold into six individual tubes with fresh LB broth without ampicillin and supplemented with IPTG (isopropyl β-D-1 thiogalactopyranoside) and arabinose to the final concentration 1 mM each. The cultures were grown at 37°C overnight. The six individual cultures were mixed and genomic DNA was isolated from the pooled cultures. The cells were lyzed by 2-min incubation with 1 mg/ml lysozyme and DNA was purified by phenol, phenol/chloroform, chloroform extractions followed by ethanol precipitation. CRISPR expansion was monitored by polymerase chain reaction (PCR) in 20 μl reactions containing 20–50 ng genomic DNA with primers matched the CRISPR leader sequence and g8 spacer: Ec_LDR-F (5′-AAGGTTGGTGGGTTGTTTTTATGG-3′) and M13g8 (5′-GGATCGTCACCCTCAGCAGCG-3′) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). Six independent amplification reactions were pooled, PCR products corresponding to expanded CRISPR cassette were gel purified using QIAquick Gel Extraction Kit (QIAGEN) and sequenced with MySeq Illumina System at Moscow State University Genomics facility as described (31).

### Data processing

Raw sequencing data were analyzed using ShortRead and BioStrings (34) packages. Illumina-sequencing reads were filtered for quality scores of ≥20 and reads containing two repeats (with up to two mismatches) were selected. Reads that contained 33-bp sequences between two CRISPR repeats were next selected. The 33-bp segments were considered spacers. Spacers were next mapped on the pG8_C1T plasmid with no mismatches allowed. R scripts and their package ggplot2 (35) were used for spacers statistics and graphical representation. Logo construction was done with http://weblogo.berkeley.edu (36).

Acquiring foreign spacer DNA into the CRISPR locus is an essential primary step of the CRISPR–Cas pathway in prokaryotes for developing host immunity to mobile genetic elements. Here, we investigate spacer integration _in vitro_ using proteins from _Pyrococcus furiosus_ and demonstrate that Cas1 and Cas2 are sufficient to accurately integrate spacers into a minimal CRISPR locus. Using high-throughput sequencing, we identified high frequency spacer integration occurring at the same CRISPR repeat border sites utilized _in vivo_, as well as at several non-CRISPR plasmid sequences which share features with repeats. Analysis of non-CRISPR integration sites revealed that Cas1 and Cas2 are directed to catalyze full-site spacer integration at specific DNA stretches where guanines and/or cytosines are 30 base pairs apart and the intervening sequence harbors several positionally conserved bases. Moreover, assaying a series of CRISPR repeat mutations, followed by sequencing of the integration products, revealed that the specificity of integration is primarily directed by sequences at the leader-repeat junction as well as an adenine-rich sequence block in the mid-repeat. Together, our results indicate that _P. furiosus_ Cas1 and Cas2 recognize multiple sequence features distributed over a 30 base pair DNA region for accurate spacer integration at the CRISPR repeat.

CRISPR repeat sequences and relative spacing specify DNA integration byPyrococcus furiosusCas1 and Cas2

### Cloning, expression and purification

The _cas1_ (PF1117) and _cas2_ (PF1118) genes were amplified from _Pyrococcus furiosus_ COM1 genomic DNA, individually cloned into pET21d expression vectors, and transformed into _Escherichia coli_ BL21 RIPL strain. Cultures were grown at 37°C in 200 ml of Luria broth to an OD600 of 0.4–0.6, and expression of the C-terminal 6× histidine tagged proteins was induced with 1 mM IPTG during overnight growth at room temperature. Harvested cells were lysed in 40 mM Tris, 500 mM KCl, 10% glycerol, 5 mM imidazole, pH 7.5. Following thermal precipitation at 70°C for 30 min, the cell lysate was centrifuged at 14 000 rpm at 4°C for 30 min and the soluble fraction was collected and filtered (0.8 μm filter pore size Millex filter unit, Millipore). His-tagged proteins were purified by Ni2+ affinity column chromatography, using a stepwise increase of imidazole (10, 20, 50, 100, 250 and 500 mM) in 40 mM Tris, 500 mM KCl, 10% glycerol, pH 7.5. Peak elution fractions were dialyzed using Slide-a-lyzer mini dialysis cassettes (Thermo Fisher) into 40 mM Tris, 200 mM KCl, 10% glycerol, pH 7.5, and stored at 4°C prior to use for functional assays. C-terminal 6× histidine tagged proteins were confirmed to be functional for adaptation _in vivo_ (data not shown), ruling out potential detrimental effects of the tag.

### DNA substrate preparation

DNA oligonucleotides were from Eurofins Genomics (for minimal CRISPR substrates and PCR primers) and Integrated DNA Technologies (for pre-spacer DNA and hairpin CRISPR substrates). Oligonucleotides used to make pre-spacers and CRISPR substrates were separated by 15% denaturing polyacrylamide gel electrophoresis in 1× TBE, detected by ethidium bromide staining, and the band of the expected oligonucleotide size was excised. Oligonucleotides were eluted from the gel slices overnight at 4°C in 500 μl of elution buffer (0.5 M ammonium acetate, 1 mM EDTA (pH 8.0), and 0.1% SDS), extracted with phenol/chloroform/isoamyl alcohol (pH 8.0), ethanol precipitated, and resuspended in 20 mM Tris, 100 mM KCl, 5% glycerol, pH 7.5. Corresponding oligonucleotides were annealed by incubating at 95°C for 5 min followed by slow cooling until 23°C. Annealing was confirmed by 10% non-denaturing polyacrylamide gel electrophoresis in 1× TBE. Pre-spacers and half-site CRISPR substrates were 5′ radiolabeled with T4 polynucleotide kinase (PNK) and [γ-32P] ATP. In the case of the half-site substrates, a second gel extraction and precipitation was performed after annealing. Oligonucleotide sequences can be found in Supplementary Table S1.

### Spacer integration assay

Unless stated otherwise, a final concentration of 1 μM Cas1, 1 μM Cas2, 1 mM DTT and 10 mM MgCl2 was incubated in reaction buffer (20 mM Tris, 100 mM KCl, 5% glycerol, pH 7.5) at 4°C for 1 h. 20 nM of radiolabed pre-spacer or 100 nM of unlabeled pre-spacer was added to the reactions and incubated at 4°C for an additional 15 min. Finally, plasmid or linear DNA was added to a final concentration of 5 nM for pCR7, or 100 nM for minimal CRISPR substrate, and the reaction was incubated at 70°C for 1 h. Reactions with pCR7 were quenched with EDTA and proteinase K (Life Technologies). Products were mixed with gel loading dye (purple, NEB) and separated on 1% agarose gels in 1× TAE. Reactions with minimal CRISPR substrates were quenched with an equal volume of Gel Loading Buffer II (Thermofisher) and 25 mM EDTA. Samples were boiled for 5 min before separation by 12% denaturing 7 M urea-containing polyacrylamide gel electrophoresis in 1× TBE. Gels were dried and radioactivity was detected with phosphorimaging (Storm 840 Scanner GE Healthcare).

### Analysis of integration by high-throughput sequencing

#### Library preparation 

To analyze integrations by high-throughput sequencing, the spacer integration assay was performed as described above using unlabeled pre-spacer. Following incubation, DNA was isolated using the DNA Clean and Concentrator Kit (Zymo Research, Irvine, CA, USA). For the plasmid integration samples, excess un-integrated pre-spacer was removed using Agencourt AMPure XP beads (Beckman Coulter, Indianapolis, IN, USA). Next, Illumina adapter sequence with an N10 random primer was annealed to the plasmid DNA and extended (thermocycler conditions: 98°C for 30 s, 25°C for 30 s, 35°C for 30 s, 45°C for 30 s, and 72°C for 5 min). Following extension, excess adapter was removed using AMPure beads, and PCR was done to amplify plasmid DNA that contained integrated pre-spacer: forward primers were specific for the pre-spacer, while reverse primers targeted the Illumina adapter introduced with the random anneal and extension step. This amplified both full-site and half-site integration events with no discrimination. Illumina barcodes and additional adapter sequences were added with a final PCR and the resulting library was separated on a 1% agarose gel to select for DNA in a 400–700 bp size range. DNA was isolated using the Zymo Gel DNA Recovery Kit (Zymo Research, Irvine, CA, USA) and sequenced on an Illumina MiSeq in a 100 by 50 cycle run. Only the 100 bp Read 1 data was used in this analysis.

For the minimal linear CRISPR substrate products, 1 μl of eluted DNA was used as a PCR template. Primers to add Illumina adaptor sequences were annealed to the newly integrated spacer and the 3′ end of either the plus or minus strand of the CRISPR substrate. DNA Clean and Concentrator Kit (Zymo Research, Irvine, CA) was used to isolate the PCR product, and 1 μl of this product was used as the template for a second PCR using primers to add Illumina barcodes. These products were purified on a 1% agarose gel and extracted with a Gel Purification Kit (Zymo Research, Irvine, CA).

#### Mapping integration events 

After sequencing, samples were de-multiplexed by barcode and analyzed to determine sites of integration. For plasmid data, the complete pre-spacer sequence was located in each read and 50 bp of sequence immediately downstream from the end of the pre-spacer was extracted. These 50 bp sequences were aligned to the appropriate plasmid reference using Bowtie (47). To visualize the distribution of integration events, alignment output files were converted into coverage files using bedtools (48) and displayed on a custom UCSC genome browser track hub (https://www.genome.ucsc.edu). An initial inspection of the integration tracks revealed that large peaks occurred outside of the CRISPR arrays and data suggested that these peaks were due to particular sequence and spatial features. These trends were both analyzed in an unbiased plasmid-wide manner. To determine sequence preferences at the sites of integration, the base at the integration point, along with upstream and downstream context sequence, was extracted from the reference sequence (bedtools) and used to make sequence logos (49). For spacing trends, we took the browser track files and assessed the distances between two large peaks occurring on the same strand or on opposite strands. To do this, 500 random 50 bp intervals (‘windows’) were selected for each plasmid. Within each of these windows, the two highest peaks on the plus strand and the minus strand were identified and the bp distance between these peaks was determined (highest to second highest on the plus strand, highest to second highest on the minus strand, highest plus strand to highest minus strand). Distance values from all 500 windows were then binned and counted. For the minimal linear CRISPR integration data, the spacer-target junction was determined from each read and counts for each potential integration point were totaled.

Go to:


Mutations in the fibrillin‐1 gene (_FBN1_) are associated with various heritable connective tissue disorders (HCTD). The most studied HCTD is Marfan syndrome. Ninety percent of Marfan syndrome is caused by mutations in the _FBN1_ gene. The zebrafish share high genetic similarity to humans, representing an ideal model for genetic research of human diseases. This study aimed to generate and characterize _fbn1_ +/− mutant zebrafish using the CRISPR/Cas9 gene‐editing technology.

CRISPR/Cas9 in zebrafish: An attractive model for FBN1 genetic defects in humans

## 2. MATERIALS AND METHODS


### 2.1. Zebrafish care and husbandry

TU wild‐type zebrafish and transgenic _Tg (cmlc2_:_eGFP)_ zebrafish possessing a green fluorescent heart (Siegert et al., 2018) were obtained from Model Animal Research Center of Nanjing University (Nanjing Jiangsu, China). Embryos were treated with 0.003% tyrosine inhibitor 1‐phenyl‐2‐thio‐urea (cat# P7629‐10G, Sigma‐Aldrich) to inhibit pigment formation. The fish were maintained at 26 ± 2℃ under a 14 hr light: 10 hr dark cycle in a zebrafish circulation breeding system (ESON; Beijing Aisheng Technology Development Co., Ltd.). To generate offspring, mating was carried out at a ratio of 1:1, followed by natural spawning.

### 2.2. Generation of Cas9 transgenic zebrafish

_fbn1_ gene has not been sequenced in many databases, this design is based on NCBI database (https://www.ncbi.nlm.nih.gov/gene/XM_017351990.2). _fbn1_ sgRNAs (CRISPR1: TGCGGAAGAGCTTGTGCTACAGG; CRISPR2: TCCGACAACGCCACATGTGACGG; CRISPR3: CCAGGCGCGGCCGATGTTGTAGG; CRISPR4: GGGAACGGGACACTTCTCGCAGG) were designed and synthesized by Nanjing YSY Biotech Company. The target sequences are in exon 16, near to the 1731st amino acid. A mixture (1 nl) of each sgRNA (80–100 ng/µl) and Cas9 protein (200 ng/µl; cat# P‐020, Nanjing YSY Biotech) was injected into embryos (F0). The F0 embryos injected with Cas9/sgRNA were raised to sexual maturity, and four pairs of female and male zebrafish were mated to obtain F1 embryos.

### 2.3. Genotyping of transgenic zebrafish

Genomic DNA was obtained from F1 embryos at 24 hr post‐fertilization (hpf) for genotyping using the forward (5′‐GAATCCTGGCATCTGTGGTC‐3′) and reverse (5′‐TTGCGCAAATCTTCTACTCAAA‐3′) primers. The PCR protocol was 95℃ for 3 min, 30 cycles of 95℃ for 30 s, 62℃ for 30 s and 72℃ for 1 min, and 72℃ for 10 min. PCR products were sequenced to identify the mutation. F0 with heritable mutations were selected to mate to generate F1 offspring, followed by genomic DNA collection at 2 months post‐fertilization for genotyping. PCR reaction was performed using the primers and PCR protocol mentioned above, followed by sequencing. To confirm the genotype carried by the mutants, the PCR products of mutant 1 and mutant 2 carrying the _fbn1_ frameshift mutation were recombined into the pGEM‐T Easy vector. After transformation, a single colony was selected for PCR identification. The confirmed F1 _fbn1_ +/− heterozygotes were used in the following investigation.

### 2.4. Morphology assessment

The F1 adult _fbn1_ +/− zebrafish were mated with _Tg(cmlc2_:_eGFP)_ fish to generate F2 transgenics. The morphology of F2 embryos/larvae and TU control group were examined at 72 hpf, 120 hpf, 12 dpf, 19 dpf, 26 dpf, 33 dpf, and 40 dpf using a stereomicroscope (MC50‐S; Mingmei). Images were acquired using an SZX7 camera (Olympus). The initial sample size was 310 in F2 fbn1+/− zebrafish experimental group and TU control group, respectively. The death rate was about 3%. The abnormal phenotypes of the F2 and TU groups were analyzed statistically. The experiment was repeated three times.

### 2.5. All reagents used in the experiment include the following

YSY buffer (cat# R‐001, Nanjing YSY Biotech), Zebrafish genotyping kit (cat# K‐101, Nanjing YSY Biotech), 2‐Mastermix (cat# P111‐01, Vazyme Biotech Co., Ltd), Ultrapure water without ribozyme pollution (cat# R‐002, Nanjing YSY Biotech), 1‐phenyl‐2‐thiourea (cat# P7629‐10G, Sigma‐Aldrich), T7 in vitro Transcription Kit (cat# P7629‐10G, TaKaRa), MAXIscript SP6/T7 (cat# AM1314, Ambion), PCR clean up Kit (cat# AP‐MN‐P‐250, Axygen), DL5000 marker (cat#3428A, TaKaRa), Ampicillin (cat# A610028, Sangon Biotech Co., Ltd), DNase I (cat# 2238G2, Ambion), PCR‐related reagent T4 ligase (cat# M0202L, New England Biolabs), PGEM‐Teasy Vector (cat# A1360, Nanjing YSY Biotech), Cas9 protein (cat# P‐020, Nanjing YSY Biotech), Conventional chemical reagent (cat# 10010360, cat# 30148126, cat# 71001453, Shanghai Chemical Reagent, Co., Ltd; cat#34943‐6X1L, cat#296821‐1L, cat# 284505‐2L, Sigma Aldrich).

### 2.6. Ethical Compliance and Ethical Considerations

The animal protocol was approved by an ethics committee of the Institutional Animal Care and Use Committee of The 1st Medical Center of Chinese PLA General Hospital (Beijing, China). All animal experiments were performed following the guidelines for animal welfare in Laboratory of Translational Medicine of The 1st Medical Center of Chinese PLA General Hospital.

CRISPR‐cas technology is being incorporated into undergraduate biology curriculum through lab experiences to immerse students in modern technology that is rapidly changing the landscape of science, medicine and agriculture. We developed and implemented an educational module that introduces students to CRISPR‐cas technology in a Genetic course and an Advanced Genetics course. Our primary teaching objective was to immerse students in the design, strategy, conceptual modeling, and application of CRISPR‐cas technology using the current research claim of the modification of theCCR5gene in twin girls. This also allowed us to engage students in an open conversation about the bioethical implications of heritable germline and non‐heritable somatic genomic editing. We assessed student‐learning outcomes and conclude that this learning module is an effective strategy for teaching undergraduates the fundamentals and application of CRISPR‐cas gene editing technology and can be adapted to other genes and diseases that are currently being treated with CRISPR‐cas technology.

“Designer babies?!” ACRISPR‐based learning module for undergraduates built around theCCR5gene

### 2.1. Intended audience and learning time

This work is intended for sophomore‐ and junior‐level undergraduate Biology students enrolled in a Genetics or Biotechnology course, but can be integrated and modified for Introductory Biology course or upper‐level Molecular Biology course. The main activity was implemented during a 2‐hour 45‐minute laboratory period. The activity can be adapted to fit two traditional 90‐minute class/lecture periods. Subsequent post‐activity student work where students created a research proposal was carried out over the next two laboratory periods and during students' own time.

#### 2.1.1. _Prerequisite student knowledge_ 

Student should have prior exposure to basic molecular genetics principles that include DNA/RNA structure, codons, reading frames, mutation. However, this lesson can be adapted to introduce and apply the concepts of codons/mutations.

### 2.2. Materials

Each student will require a computer/laptop with access to the internet and the software program, SnapGene Viewer (full version, https://www.snapgene.com). A free 30‐day trial to SnapGene Viewer can be downloaded by each student with their email address. Alternative molecular biology software could be used with modifications to the below resources.

The student handouts and accompanying instructor guide/key are provided in Supporting Information.

### 2.3. Instructions for faculty and students

#### 2.3.1. _Comparative analysis of_ _CCR5_ _gene and modified allele variants on paper_ 

The activity utilizes the gene encoding human CCR5; the intended target gene used in Dr. He's study. _CCR5_ gene encodes for a chemokine GPCR in T cells, and was targeted because of the known role of the CCR5 as a co‐receptor in HIV infection of humans. 28 _CCR5_ delta 32 (Δ32) is a naturally occurring allele lacking 32 nucleotides that correspond to a sequence that normally codes for part of the co‐receptors second extracellular loop. 28 Removing these 32 nucleotides results in a premature stop codon due to frameshift, and the resultant truncated protein product can no longer be exocytosed to the cell membrane. 29 Individuals homozygous for the _CCR5_ Δ32 variant are resistant to HIV infection, as CCR5 is required for membrane fusion during HIV infection. The HIV life cycle and the key molecular components of a HIV infection cycle in immune T cell can be introduced to students using this animation by Janet Iwasa. 30

Dr. He's goal of editing human embryos was to create a similar non‐functional HIV‐resistant CCR5 variants using CRISPR‐cas technology. 31 However, the results of these experiments have purportedly generated three new _CCR5_ allelic variants named after the twin girls, Lulu and Nana, with Lulu being heterozygotic for a novel _CCR5_ variant (the Lulu _CCR5_ allele) and wild‐type allele, and Nana being heterozygotic at the _CCR5_ locus (Nana _CCR5_ alleles 1 and 2 respectively). 4 , 31 He also claimed that a third child has been genetically modified in a similar manner.

To begin their comparative analysis of the different alleles, students were given a worksheet (Supporting Information) that contains the partial coding DNA sequences of an unmodified _CCR5_ allele, the HIV resistant allele Δ32 _CCR5_, and three novel alleles generated via CRISPR‐cas9‐based modification. They were tasked to determine the nucleotide differences between them and the effect on the reading frame, codon and amino acid (Figure ​(Figure2a,2a, example of student work; Table ​Table2,2, summary of CRISPR alleles). Students worked on their own initially and then in a group to compare answers.

  FIGURE 2

Student work aligning unmodified _CCR5_ allele to HIV resistant Δ32 and CRISPR‐cas modified alleles (a) on paper, and (b) using computer software program SnapGene. B) shows all alleles aligned to the unmodified allele. Panel (c) shows an expanded alignment view with the change in reading frame and early stop codon (red asterisks). Expanded alignment views for other modified alleles are shown in Figure S1

### TABLE 2

The effect of _CCR5_ mutant alleles on reading frame and protein structure

**AlleleNucleotide change in coding sequenceEffect on reading frame (RF)Effect on amino acidsProtein lengthProtein structure**Unmodified _CCR5_Normal (RF +1)3527 TM domains with extracellular N′ and intracellular C′Delta 32 (Δ32) _CCR5_Deletion of 32 nucleotides (911..942)Frameshift (RF +3) leading to early stop codonNew amino acids on C terminus (31 different amino acids from AA185)215Lacks 3 TM domains, altered C′ protein sequence after TM 3Lulu allele (Delta 15)Deletion of 15 nucleotides (900..914)In‐frame deletionDeletion of 5 amino acids from AA181 in extracellular loop 2347Extracellular loop 2 missing 5 AA

Nana allele 1

(Delta 4)

Deletion of 4 nucleotides (913..916)Frameshift leading to early stop codon (RF +2)9 different amino acids on C terminus from AA186194Lacks 3 TM domains, altered C′ protein sequence after TM 3Nana allele 2 (Plus 1)Addition of 1 nucleotide at bp 911Frameshift (RF +3) leading to early stop codon42 different amino acids on C terminus from AA185(31 of the amino acids are the same as Δ32)226Lacks 3 TM domains, altered C′ protein sequence after TM 3Open in a separate window

#### 2.3.2. _Comparative analysis of_ _CCR5_ _gene and modified allele variants on computer_ 

Students were guided to obtain the full reference coding sequence of _CCR5_ from NCBI (Accession number NM_000579). They created a “new sequence” in the DNA analysis software SnapGene. Students were tasked to create “new features” that represent the three exons to show where intron/exon boundaries would exist in genomic DNA. Using the open reading frame feature, the students determine the translated protein sequence and normal length of protein. They were given the three other new allele variants (Δ32, Lulu, Nana allele 1 and Nana allele 2) that had been created by the instructor based on reported CRISPR modified sequences. 32 Students were guided to align these sequences together and determine the nucleotide, reading frame, amino acid sequence and protein length changes that were created. The use of the full version SnapGene is key in visualizing the alignment. Although NCBI and free DNA softwares ApE and Benchling enables alignment of sequences together, the alignment in Snapgene is presented in an effective scheme that enables students to still visualize the double‐stranded DNA molecule with polarity of each DNA strain, the resulting translation, and the features labeled in one window (Figure 2b,c, Figure S1). Students compared their analysis on SnapGene to their worksheet. Using SnapGene allows students to determine whether premature stop codons are formed further downstream from the nucleotide change.

#### 2.3.3. _Predicting the effect of the mutations on protein structure_ 

The nucleotide sequence alignment allows students to visualize the effect on the linear primary sequence of the protein, but it is important that students move beyond the linear protein sequence and establish the effects of changes in the primary sequence to the tertiary structure. Students were shown published tertiary structures of the CCR5 protein 33 , 34 where the unmodified protein consists of seven transmembrane helices, characteristic of all G protein‐coupled receptors. Additionally, the web‐based 3D structure viewer iCn3D can be used by students to visualize the tertiary structure of the protein. The students were tasked to discuss and predict how the new alleles affect protein structure and draw the various predicted protein structures out on paper. Students of the Advanced Genetics class utilized the software BioRender (https://biorender.com), a free biology drawing software to create their schematics. Examples of student work are shown in Figure 3a,b.

  FIGURE 3

Student work depicting protein structure of CCR5 and predicted structures of its various modified versions (a) on paper and (b) using Biorender. Nucleotide sequences that were inserted or deleted are indicated, and nucleotides shared between Δ32 and Nana+1 alleles are highlighted

#### 2.3.4. _CRISPR‐cas9 editing design and strategy of_ _CCR5_ _gene_ 

Students were guided to design the strategy to program the cas9 nuclease to target and cut _CCR5_ gene at the appropriate region in order to create a loss‐of‐function CCR5 protein. Specifically, students identified and designed 3 key components: (a) the cas9 nuclear target sequence in _CCR5_, (b) the protospacer adjacent motif (PAM) sequence in _CCR5_ gene utilized by cas9, and (c) the complementary guide RNA that is guided to the target sequence by cas9 (Figure ​(Figure44).

  FIGURE 4

Necessary components for CRISPR‐cas9‐based genetic modifications. (a) cas9 and gRNA form a complex, then gRNA base pairs with complementary sequence in CCR5 gene with PAM aiding in bringing cas9 nuclease in, resulting in cas9 double‐stranded cleavage 3 nucleotides from PAM sequence. (b) A comparison of endogenous DNA repair mechanisms, non‐homologous end joining (NHEJ) and homology directed repair (HDR), which utilizes a repair template containing the desired nucleotide change. Nana alleles Δ4 and +1 are shown as outcomes of NHEJ, and HIV resistant Δ32 is shown as an outcome of HDR with the use of an appropriate repair template

Using the reference unmodified _CCR5_ gene, students utilized the “features” tool on SnapGene to identify and annotate the cas9 specific PAM sequence (5′NGG3′) chosen by Dr. He that was presented in his oral presentation at the Second International Summit on Human Genome Editing meeting (Start at: 1:17:57). 8 The guanine dinucleotides of the PAM sequence that is on the non‐target strand of the gRNA interacts with arginine amino acids of cas9 to assist the unwinding of double‐stranded DNA for subsequence nuclease activity (as reviewed in Chen and Doudna 3 ). Next, students were guided to label the target sequence of the cas9 nuclease, which are the 20 nucleotides upstream of the 5′TGG3′ PAM sequence (Figure ​(Figure5a).5a). The cas9 nuclease is brought to the target sequence by the single guide RNA, which is composed of an RNA sequence complementary to the target strand and an 80‐mer universal scaffold region that aids in cas9 binding. To model formation of gRNA‐cas9‐target DNA complexes, students were tasked to hand draw how all these components interact, labeling important components and sites including their PAM sequence, the location of the cas9 cut site, the annealing of the gRNA to its specific target nucleotide sequence. We intentionally had students draw this out based on our prior teaching experiences where assessment revealed students found it challenging to conceptualize the action and polarity of gRNA and cas9 complex with two complementary DNA strands (target and non‐target strands) of the target gene. 19

  FIGURE 5

Key components utilized by CRISPR‐cas9 system. View in SnapGene of (b) PAM sequence (green) and gRNA‐cas9 target sequence (light green) are annotated in unmodified CCR5 allele in top half. Potential PAM sequences are highlighted in yellow. Bottom half shows the alignment with Δ32 allelic variant to allow visualization of which PAM sequence is most appropriate. (b) An example HDR repair template lacking the 32 nucleotides missing in the Δ32 allelic version, and containing two homology arms. The blue line indicates where the 32 nucleotides in Δ32 allelic version has been deleted. (c) Student work showing a schematic of gRNA and cas9 complexing with target sequence in _optix_ gene

Students were prompted to discuss why this specific PAM associated with the target sequence was chosen of all possible PAM sequences of (5′NGG3′) as a quick “Find” of “GG” highlights in yellow all the GGs present in the sequence (yellow boxes, Figure ​Figure5a),5a), and students observe that there are many potential PAM sequences present throughout the gene. The discussion led the class to conclude that this specific 5′NGG3′ was chosen of many potential 5′NGG3′ because of the necessity for cas9 cut the _CCR5_ genomic DNA in close proximity to the physical location of the desired nucleotide change that could potentially give rise to Δ32 allele variant.

#### 2.3.5. _Interpreting_ _DNA_ _repair mechanisms that created Nana and Lulu alleles; designing a homology directed repair (HDR) repair template_ 

Identification of the likely _CCR5_ PAM sequence and cas9 cut site was followed by discussion of the outcomes for the _CCR5_ gene after cas9 cleavage, and how different endogenous repair mechanisms are used to achieve different research goals. Animation are shown to illustrate the two processes. 35 , 36 The process of non‐homologous end joining (NHEJ) is used after cas9 makes the double stranded cut to produce indels and potential loss‐of‐function alleles due to frameshift mutations. Homology Directed Repair (HDR) is typically utilized when a specific nucleotide change is desired. HDR requires the addition of a repair template with homology arms that enables the cell to utilize HDR to incorporate a desired nucleotide sequence after the cas9‐mediated dsDNA cut. As a class, we discussed the features that the HDR must contain: (a) the desired nucleotide change, (b) regions of DNA that were similar to the original allele (homology arms), and (c) a PAM sequence that was altered such that the repair template would not be cut by cas9. Students were guided to create an HDR template in SnapGene (Figure ​(Figure5b).5b). Students were then asked to work in groups to discuss which DNA repair strategy was likely utilized by Dr. He to produce the three new variant alleles found in Nana and Lulu. Most students report that NHEJ occurred in the embryos to create the three new variants and that a repair template was likely not used as the HIV resistant Δ32 allele was not found in Lulu and Nana.

#### 2.3.6. _Putting knowledge into practice:_ _CRISPR‐cas9 gene editing strategy with butterfly wing patterning gene optix and human oncogenic Ras gene_ 

Students worked on two follow‐up hypothetical scenarios to practice the CRISPR design and strategy of sgRNA and target sequence. The first scenario was that students were investigating the function of the gene _optix_ in _Lepidoptera_ butterflies, and were tasked to design a CRISPR‐cas9 strategy to create a loss‐of‐function _optix_ gene. The students were shown published results of a CRISPR‐cas9 strategy, where _optix_ CRISPR‐ed butterflies displayed color and patterning defects. 37 An example of student work is shown in Figure ​Figure5c.5c. The second scenario was that they had cultured cancer cells growing in lab with Ras gene that has the oncogenic mutation that causes abnormal cell proliferation. 38 , 39 The students' goal was to design a strategy to take this mutant Ras and genetically modify it to wild‐type Ras. They were given the coding sequence for the Ras gene in SnapGene with the oncogenic mutation causing 12th amino acid Glycine to Valine change (G12V). Students were asked to discuss in pairs what they would predict the phenotypic change would be after successful gene edit. The work was submitted to be checked by the instructor.

#### 2.3.7. _Bioethics discussion on implications of_ _CRISPR‐cas9 technology and_ _CCR5_ _editing in human society_ 

Following the exercise, we engaged the students in a robust bioethical discussion on the bioethical implications of CRISPR‐cas9 technology and the modification of the CCR5 gene. Questions that were posed to students for discussion are included in the Tables S2 and S3. One topic was the discussion of the novel and Δ32 mutations on CCR5's normal function in human health and disease. Whether Dr. He's novel _CCR5_ mutations in the twins actually confer HIV protection or has an effect on normal immune function has not been published yet. We asked students whether Lulu and Nana should be monitored by a specialized group of doctors and researchers for unintended consequences of their genetic edits since they have novel modified alleles that have not been studied before. Since Dr. He's made his claim, studies show that humans who are carriers for the Δ32 _CCR5_ allele have a faster recovery from strokes. 40 Furthermore, _CCR5_ plays a role in brain cognition, as mice that lack CCR5 have improved memory. 41

CRISPR-Cas12a represents an efficient tool for genome editing in addition to the extensively investigated CRISPR-Cas9. However, development of efficient nonviral delivery system for CRISPR-Cas12a remains challenging. Here, we demonstrate a DNA nanoclew (NC)–based carrier for delivery of Cas12a/CRISPR RNA (crRNA) ribonucleoprotein (RNP) toward regulating serum cholesterol levels. The DNA NC could efficiently load the Cas12a/crRNA RNP through complementation between the DNA NC and the crRNA. Addition of a cationic polymer layer condensed the DNA-templated core and allowed further coating of a charge reversal polymer layer, which makes the assembly negatively charged under a physiological pH but reverts to positive charge under an acidic environment. WhenPcsk9was selected as the target gene because of its important role in regulating the level of serum cholesterol, efficientPcsk9disruption was observed in vivo (~48%), significantly reducing the expression of PCSK9 and gaining the therapeutic benefit of cholesterol control (~45% of cholesterol reduction).

CRISPR-Cas12a delivery by DNA-mediated bioresponsive editing for cholesterol regulation

### Materials

All reagents were ordered from Sigma-Aldrich (St. Louis, MO, USA) unless specified otherwise. Linear PEI (molecular weight, 40 kDa) was obtained from Polysciences Inc. (Warrington, PA, USA). U2OS and 3T3-L1 were obtained from the American Type Culture Collection (ATCC). U2OS.EGFP reporter cell line was obtained from J. K. Joung at Massachusetts General Hospital (_36_).

### Methods

#### Expression and purification of Cas12a 

The ORF of humanized Cas12a was amplified from plasmid pY016 (Addgene #69988) (_13_) using primers Cas12a-f/Cas12a-r (table S1), and the purified amplicon was then cloned into the Bam HI and Hind III sites of a bacterial expression vector (pET-28a). An NLS was appended on the C terminus of Cas12a. _E. coli_ Rosetta (DE3) pLysS was used as the host for Cas12a expression as described before (_37_). Briefly, the _E. coli_ strain with pET-28a-Cas12a was seeded in LB medium (5-ml medium with kanamycin and chloromycetin supplemented at 10 and 34 μg/ml). The cells were cultured at 220 rpm overnight and then transferred into a 500-ml LB medium supplemented with the same concentrations of kanamycin and chloromycetin. When the OD600 (optical density at 600 nm) of the _E. coli_ reached 0.6 to 0.8 after 2 to 3 hours of continued culture, isopropyl β-d-1-thiogalactopyranoside (IPTG) was added (0.5 M). Induction of Cas12a expression was done at 20°C for 8 hours before harvest. Cas12a was subsequently purified through the Ni-NTA agarose beads (Qiagen)–based chromatography. The cells were centrifuged at 4000_g_ for 15 min, washed once with H2O, and resuspended in suspension buffer containing tris-HCl buffer (20 mM pH 8.0), imidazole (10 mM), NaCl (0.5 M), and phenylmethylsulfonyl fluoride (1 mM). The cells were then lysed using a probe sonicator. After removing cell debris by high-speed centrifugation (20,000_g_) for 20 min, supernatant containing Cas12a was loaded into Ni-NTA resin column and equilibrated for 1 hour. Unbound proteins were removed with wash buffer containing tris-HCl buffer (20 mM pH 8.0), imidazole (60 mM), and NaCl (0.5 M). Cas12a was then eluted with a buffer that contains tris-HCl buffer (20 mM pH 8.0), imidazole (500 mM), and NaCl (0.5 M). The obtained Cas12a was dialyzed overnight in a buffer that was composed of Hepes (20 mM, pH 7.0), KCl (150 mM), dithiothreitol (1 mM), and glycerol (10%). The purified Cas12a was then analyzed by 12% SDS-PAGE (polyacrylamide gel electrophoresis) for purity and quantified by Bradford assay (Bio-Rad).

#### In vitro transcription and purification of crRNA 

The crRNAs were designed with the assistance of Benchling (http://benchling.com). The transcription templates containing a T7 promoter and the crRNA were synthesized by Integrated DNA Technologies (IDT). Sequences of the template for in vitro transcription of crRNA were listed in table S1. The crRNAs were transcribed in vitro using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). The transcribed crRNA products were purified using the MEGAclear Transcription Clean-Up Kit (Ambion). Purity and yield of the obtained crRNA were examined using NanoDrop 2000c (Thermo Fisher Scientific).

#### In vitro cleavage assay of Cas12a/crRNA RNP 

To test the DNA cleavage activity of Cas12a/crRNA RNP in vitro, plasmid DNA pCAG-EGFP acquired from Addgene (#11150) (_54_) was used as the substrate. Plasmid DNA was amplified in _E. coli_ DH5α and purified with the GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific). The plasmid was linearized with Pvu I (NEB) and purified again before use. Cas12a was complexed with crRNA-EGFP, and its cleavage led to cleavage of the plasmid DNA. The cleavage reaction was performed in 20-μl NEBuffer 3 containing 300 ng of pCAG-EGFP plasmid, 160 ng of Cas12a, and 14 ng of crRNA. The reaction was kept under 37°C for 1 hour, and the cleavage bands were analyzed by 0.8% agarose gel electrophoresis and stained by GelRed (Biotium) for visualization.

#### Preparation of the DNA NCs 

DNA NCs for loading the Cas12a/crRNA RNP were synthesized by RCA. Sequences of the primer and templates were shown in table S1, where sequences with complete or partial complementation to the target crRNA were incorporated to adjust the interaction between the DNA NCs and Cas12a/crRNA RNP. A palindromic sequence was incorporated to induce the self-assembly of the DNA NC. The templates were 5′-phosphorylated linear single-stranded DNA ordered from IDT. It was cyclized with CircLigase II ssDNA ligase (Epicenter), and the remaining ssDNA was removed by treating the template DNA with Exonuclease I (NEB). After heat inactivation of Exonuclease I, the template (10 pmol) was hybridized with the primer (0.5 μM) in a 1-ml isothermal amplification buffer (NEB) under 95°C for 5 min. After cooling the mixture to room temperature, Bst 2.0 DNA polymerase was added (0.2 U/μl) and the RCA reaction was conducted under 60°C for 17 hours. Precipitates from the reaction were removed by centrifugation at 14,000_g_ for 2 min, and the obtained DNA NC was dialyzed against deionized water in a Slide-A-Lyzer dialysis unit (20-kDa molecular weight cutoff) for 48 hours. Purity and concentration of the synthesized DNA NCs were analyzed using NanoDrop 2000c. Agarose gel electrophoresis (0.8%) was also performed to analyze the DNA NCs.

#### Preparation of the assembly 

The purified Cas12a and crRNA were mixed at equimolar ratio in PBS, and the mixture was incubated at room temperature for 5 min for complexing Cas12a with crRNA. The Cas12a/crRNA RNP was then mixed with DNA NC at a weight ratio of 4:1 and incubated at room temperature for another 5 min to obtain Cas12a/crRNA/NC. PEI was then coated on the assembly with different weight ratios of PEI:DNA NC (0:1 to 3:1), and the Cas12a/crRNA/NC/PEI assembly was equilibrated at room temperature for 5 min. To find the optimal concentration of the Gal-PEI-DM layer for the assembly, Gal-PEI-DM was added to the solution at different weight ratios to PEI (0:1 to 3:1). Hydrodynamic size and zeta potential of the assembly were measured using a Zetasizer (Malvern). Transmission electron microscopy (TEM) imaging was performed with 2% uranyl acetate as the negative stain on a JEM-2000FX TEM. The assembly was also imaged by CLSM to confirm the colocalization of the layers (SP5, Leica), where Gal-PEI-DM was modified with AF647, PEI was stained with FITC, and the DNA NC was visualized by Hoechst 33342.

#### Zeta potential measurement for the charge reversal process 

The charge reversal behavior of the assembly was analyzed by measuring the zeta potentials of the assembly under different pH. The assembly was dissolved in 0.1 M PBS of different pH (7.4, 6.5, and 5.5). The samples were incubated at 37°C with constant stirring. Aliquots were taken from the incubation at planned time intervals, and the zeta potentials were measured using a Zetasizer (Malvern).

#### In vitro hemolysis assay 

Human red blood cells (RBCs) suspended in PBS were obtained from Thermo Fisher Scientific. The human RBC was washed with PBS at 500_g_ for 5 min and then diluted in PBS at pH 7.4 for the assay. The assemblies were prehydrolyzed in PBS with different pH (7.4, 6.5, and 5.5) for 8 hours before incubating with human RBC (100 μg/ml in terms of Gal-PEI-DM) for another 2 hours in PBS at pH 7.4. Human RBC treated with 0.5% Triton X-100 was used as the positive control, while human RBC treated with PBS at pH 7.4 was used as the negative control. After the incubation, intact human RBC was precipitated by centrifugation at 500_g_ for 5 min. The absorbance of the supernatant was recorded on a plate reader at 420 nm (Tecan).

#### Intracellular distribution of the assembly 

For convenient imaging of the intracellular distribution of the assemblies, U2OS (ATCC HTB-96) cells were seeded in glass-bottomed confocal dishes (MatTek) and incubated for 24 hours before the treatment with assemblies. Assemblies containing Cas12a-AF647 was then incubated with the cells for 2, 4, and 6 hours. The cells were then washed with cold PBS twice and stained for 30 min with LysoTracker Green at 50 nM (Life Technologies) and 10 min with Hoechst 33342 (1 μg/ml). The stained cells were washed with cold PBS twice again and imaged with CLSM immediately.

#### In vitro EGFP disruption and cytotoxicity assay 

U2OS.EGFP cells were seeded in 24-well plates and cultured for 24 hours before the treatment with assemblies. When the cells are approximately 70% confluent, 0.5 ml of Opti-MEM medium containing Cas12a/crRNA-loaded assemblies was used to replace existing culture medium. After 4 hours of incubation, the Opti-MEM was replaced with full serum medium and the cells were allowed to grow for another 48 hours. The cells were then imaged using a fluorescence microscope (IX71, Olympus). Percentage of GFP disruption was quantified by flow cytometry (CytoFLEX, Beckman Coulter; LSRII, Becton Dickinson). To evaluate the cytotoxicity during gene editing, a TO-PRO-3 live/dead stain–based assay was adopted after the EGFP disruption assay. The cells were then washed with PBS and stained with TO-PRO-3 live/dead stain (1 μM) for 15 min. Signal of TO-PRO-3 was also analyzed by flow cytometry.

#### In vitro Pcsk9 gene disruption 

For in vitro disruption of _Pcsk9_, mouse cell line 3T3-L1 was used. Specific crRNAs were designed to target exons 2 and 3 of _Pcsk9_ gene. 3T3-L1 cells were seeded in six-well plates and cultured for 24 hours before the treatment with assemblies. When the cells grow to 70% confluency, the culture medium was replaced with 1 ml of Opti-MEM containing assemblies loaded with _Pcsk9_ targeting Cas12a/crRNA RNP (Cas12a at 200 nM). Four hours after the treatment, the medium was replaced with full serum medium. Two days after incubating 3T3-L1 cells with the formulations, genetic alterations were analyzed by T7EI assay.

#### In vivo biodistribution 

All animal studies were performed following the animal protocol approved by the Institutional Animal Care and Use Committee (IACUC) of the University of North Carolina (UNC) at Chapel Hill and North Carolina State University. C57BL/6 male mice (5 to 6 weeks) were purchased from the Jackson Laboratory and used throughout this study. Cas12a was labeled with Cy5.5 for in vivo imaging. The mice were intravenously injected with assembly containing Cas12a-Cy5.5 via the tail vein. The mice were imaged on the IVIS Lumina imaging system (Caliper) 1 hour after administration of the assembly. The mice were euthanized, and major organs were harvested for ex vivo imaging, including heart, liver, spleen, lung, and kidney. Quantification of fluorescence intensities of the regions of interest was done with the Living Image Software.

#### In vivo Pcsk9 disruption 

C57BL/6 male mice (5 to 6 weeks) were intravenously injected with the assemblies. The mice were divided into three groups (_n_ = 5): PBS, Cas12a/crRNA-control/NC-control/PEI/Gal-PEI-DM, and Cas12a/crRNA-exon3/NC-exon3/PEI/Gal-PEI-DM. Each mouse was injected with assemblies containing 50 μg of Cas12a (~2.5 mg/kg mouse) every other day (days 1, 3, and 5) for three times. The mice were fed under normal conditions for another week until the extraction of tissue and blood samples (day 12). After overnight fasting (day 13), the mice were euthanized for liver and peripheral blood collection. From the serum samples, PCSK9 levels were determined using the Mouse PCSK9 ELISA Kit (R&D Systems). Serum cholesterol, ALT, and albumin levels were tested at the UNC Histopathology and Laboratory Medicine. Genomic DNA of the collected livers was extracted for T7EI assay and deep sequencing. Other major organs of the mice were also harvested for H&E staining to assess potential pathological abnormalities.

#### T7EI assay 

Genomic DNA of collected tissues or cells was extracted using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific) following the manufacturer’s manual. Polymerase chain reaction (PCR) amplicons of the targeted region were amplified with Phusion Hot Start II High Fidelity DNA polymerase (NEB). Potential off-target sites similar to _Pcsk9_ exon 3 were identified by Benchling (_55_). Primers for the amplicons were shown in table S2. A touchdown PCR program was used to generate the amplicons with reduced nonspecific bands: 10 cycles of (98°C, 10 s; 66 to 56°C, −1°C/cycle for 15 s; 72°C, 60 s) followed by 25 cycles of (98°C, 10 s; 56°C, 15 s; 72°C, 60 s). The obtained amplicons were gel-purified for the T7EI assay. In a reaction mixture containing 1 × NEBuffer 2 (20 μl), 200 ng of purified amplicons was added and annealed by heating at 95°C for 5 min. After cooling to room temperature, 1 μl of T7EI nuclease (10 U/μl, NEB) was added and the cleavage reaction was performed under 37°C for 15 min. The cleaved amplicons were analyzed by 2% agarose gel electrophoresis with GelRed to visualize the DNA. Indel formations were quantified by ImageJ.

#### Deep sequencing 

The next-generation sequencing was applied to quantify on-target disruption of _Pcsk9_ of the treated liver. Liver DNA was extracted as mentioned above, and amplicons centered on the targeted region were amplified using primers in table S2. A 150-bp region was amplified by touchdown PCR and gel-purified. Deep sequencing was performed in UNC Genomics Core. Sequencing library was prepared with a KAPA Hyper Prep kit (Kapa Biosytems), and the library was subjected to MiSeq (Illumina) using 150-bp runs. Cas-analyzer was used to analyze the indels (_56_).

#### Statistics 

All data were presented as mean value ± SD from independent tests. Statistical analysis between different treatment groups was done by Student’s _t_ test. The difference was considered significant when _P_ < 0.05.

Go to:


Clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) proteins provide microbial adaptive immunity against invading foreign nucleic acids. In type II-A CRISPR–Cas systems, the Cas1–Cas2 integrase complex and the subtype-specific Csn2 comprise the CRISPR adaptation module, which cooperates with the Cas9 nuclease effector for spacer selection. Here, we report the molecular organization of the _Streptococcus pyogenes_ type II-A CRISPR adaptation module and its interaction with Cas9 via Csn2. We determined the crystal structure of _S. pyogenes_ type II-A Cas2. Chromatographic and calorimetric analyses revealed the stoichiometry and topology of the type II-A adaptation module composed of Cas1, Cas2 and Csn2. We also demonstrated that Cas9 interacts with Csn2 in a direct and stoichiometric manner. Our results reveal a network of molecular interactions among type II-A Cas proteins and highlight the role of Csn2 in coordinating Cas components involved in the adaptation and interference stages of CRISPR-mediated immunity.

Molecular organization of the type II-A CRISPR adaptation module and its interaction with Cas9 via Csn2

### Cloning, expression and purification

The _S. pyogenes cas1_ and _cas9_ genes were cloned into pET28a vectors with a C-terminal (His)6 tag (Supplementary Table S1). The _S. pyogenes cas2_ and _csn2_ genes were cloned into pET28a and pHMGWA vectors, respectively, each of which contain an N-terminal (His)6-maltose binding protein (MBP) tag and a tobacco etch virus (TEV) protease cleavage site (Supplementary Table S1). _E. coli_ BL21 (DE3) cells transformed with each individual construct were cultured in lysogeny broth (LB) medium at 37°C until the optical density at 600 nm reached 0.7. Protein expression was induced by the addition of 0.3 mM isopropyl-β-d-thiogalactopyranoside, followed by incubation at 17°C for 16 h. Cells were harvested by centrifugation and resuspended in lysis buffer (300 mM NaCl, 10% (w/v) glycerol, 5 mM β-mercaptoethanol (BME) and 20 mM Tris–HCl (pH 8.0)).

After sonication and centrifugation, the supernatant was loaded onto a 5 ml HisTrap HP column (GE Healthcare, USA) that was pre-equilibrated with elution buffer (300 mM NaCl, 10% (w/v) glycerol, 5 mM BME, 30 mM imidazole, 20 mM Tris–HCl (pH 8.0)). After washing the column with elution buffer, the bound protein was eluted by applying a linear gradient of imidazole (up to 450 mM). The (His)6-MBP tag of Csn2 was cleaved with TEV protease and separated by using a 5 ml HisTrap HP column (GE Healthcare), whereas that of Cas2 was maintained due to the solubility issue. Cas1 was further purified using a 5 ml HiTrap Heparin HP column (GE Healthcare). All proteins were finally purified using a HiLoad 16/60 Superdex200 column (GE Healthcare) equilibrated with SEC buffer (200 mM NaCl, 10% (w/v) glycerol, 2 mM dithiothreitol (DTT), 20 mM Tris–HCl (pH 8.0)).

The Cas1–(His)6-MBP-Cas2 complex was generated by co-expression. The genes of Cas1 and Cas2 were cloned into pET21a, which does not contain a tag, and pET28a, which includes an N-terminal (His)6-MBP tag, respectively. Cas1 and (His)6-MBP-Cas2 were co-expressed in _E. coli_ BL21 (DE3) cells containing both constructs. The expression was induced as described above for the individual Cas proteins. The Cas1–(His)6-MBP-Cas2 complex was purified in a three-step procedure using a HisTrap HP column, a HiTrap Heparin HP column and a HiLoad 16/60 Superdex200 column (GE Healthcare).

### Crystallization and structure determination of Cas2

To determine the crystal structure of _S. pyogenes_ Cas2, we generated a truncated _cas2_ construct, in which the first N-terminal five residues were replaced with a Ser-Gly-Ser-Gly-Ser segment, and the C-terminal tail (residues 92–113) was removed. This construct was cloned into a pET28a vector containing an N-terminal (His)6-MBP tag and a TEV protease cleavage site (Supplementary Table S1). The protein was expressed and purified as described above for Csn2 without the (His)6-MBP tag. Crystals were grown at 20°C by the sitting-drop vapor diffusion method from 14 mg/ml protein solution in buffer (300 mM NaCl, 5% (w/v) glycerol, 5 mM BME, 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (pH 7.0)) mixed with an equal amount of reservoir solution (22.0% (w/v) polyethylene glycol (PEG) 4000, 325 mM ammonium sulfate, 0.1 M sodium acetate (pH 4.6)). To determine the crystal structure using single-wavelength anomalous diffraction, the selenomethionyl protein was expressed in _E. coli_ BL21 (DE3) cells grown in M9 medium supplemented with SeMet, as described previously (42). The selenomethionyl protein was purified as described above for the native protein, and its crystals were grown under similar conditions (26.5% (w/v) PEG 4000, 225 mM ammonium sulfate, 0.1 M sodium acetate (pH 3.6)). The native and selenomethionyl crystals were flash-frozen in liquid nitrogen without additional cryo-protective reagents.

Diffraction data were collected at the beamline 7A of the Pohang Accelerator Laboratory at 100 K. Diffraction images were processed with HKL2000 (43). Determinations of selenium positions, density modification and initial modeling of the selenomethionyl protein were done using PHENIX (44). The initial model of the selenomethionyl structure was used for phasing of the native structure in PHASER (45). The structure of the native protein was completed using alternate cycles of manual fitting in COOT (46) and refinement in PHENIX (44). The stereochemical quality of the final model was assessed using MolProbity (47).

### Analytical SEC

Analytical SEC was performed on Superdex 200 10/300 GL columns (GE Healthcare). The columns were equilibrated with buffer (150 mM NaCl, 2 mM DTT, 20 mM Tris–HCl (pH 8.0)). To test complex formation, protein samples were incubated together in buffer (200 mM NaCl, 2 mM DTT, 20 mM Tris–HCl (pH 8.0)) at 4°C for 1 h and loaded onto one of the columns at a flow rate of 0.5 ml/min. Control experiments for single protein components were performed as references in the same column as their mixtures. A standard curve for the SEC column is provided in Supplementary Figure S1. Experiments with varying salt concentrations were performed by applying different amounts of NaCl to the column. Elution fractions were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and visualized by Coomassie staining.

### ITC

The ITC experiments were performed at 25°C using a MicroCal iTC200 system (GE Healthcare). Proteins in a 200 μl sample cell were titrated with 20 consecutive 2 μl injections in buffer (150 mM NaCl, 10% (w/v) glycerol, 20 mM Tris–HCl (pH 8.0)). Origin software (OriginLab) was used for processing and analysis of the ITC titration data with a fitting model assuming multiple identical independent binding sites.

### SPR

The SPR binding assays were performed using a CM5 chip on a Biacore T200 (GE Healthcare). The amine coupling ligand immobilization procedure was performed at a flow rate of 5 μl/min. The CM5 chip was activated with a mixture of 0.1 M N-hydroxysuccinimide and 0.4 M 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride at a ratio of 1:1 for 400 s. Subsequently, 60 μg/ml of Cas9 dissolved in 10 mM sodium acetate (pH 5.0) was injected for 30 s. The remaining activated carboxyl groups on the sensor chip surface were deactivated with 1 M ethanolamine (pH 8.5) for 400 s. The multi-cycle analysis was performed at a flow rate of 30 μl/min. Each concentration of Csn2 in running buffer (150 mM NaCl, 10 mM Tris–HCl (pH 8.0)) was injected for 600 s, followed by dissociation for 1200 s in a separate analysis cycle. The sensor chip surface was regenerated with 10 mM NaOH between cycles. Data were fit with the bivalent analyte model. The equilibrium dissociation constant (_K_d) was determined based on kinetic rate constants calculated using Biacore T200 evaluation software (GE Healthcare).

A variety of techniques for strain engineering inSaccharomyces cerevisiaehave recently been developed. However, especially when multiple genetic manipulations are required, strain construction is still a time-consuming process. This study describes new CRISPR/Cas9-based approaches for easy, fast strain construction in yeast and explores their potential for simultaneous introduction of multiple genetic modifications. An open-source tool (http://yeastriction.tnw.tudelft.nl) is presented for identification of suitable Cas9 target sites inS. cerevisiaestrains. A transformation strategy, usingin vivoassembly of a guideRNA plasmid and subsequent genetic modification, was successfully implemented with high accuracies. An alternative strategy, usingin vitroassembled plasmids containing two gRNAs, was used to simultaneously introduce up to six genetic modifications in a single transformation step with high efficiencies. Where previous studies mainly focused on the use of CRISPR/Cas9 for gene inactivation, we demonstrate the versatility of CRISPR/Cas9-based engineering of yeast by achieving simultaneous integration of a multigene construct combined with gene deletion and the simultaneous introduction of two single-nucleotide mutations at different loci. Sets of standardized plasmids, as well as the web-based Yeastriction target-sequence identifier and primer-design tool, are made available to the yeast research community to facilitate fast, standardized and efficient application of the CRISPR/Cas9 system.

CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications inSaccharomyces cerevisiae

The use of CRISPR-Cas9 has transformed our ability to edit genome sequences from bacteria to humans. Here, we describe a species-specific version of CRISPR-Cas9 that has been modified from that developed for the relatedCandidaclade speciesCandida albicans(23,24). Our results highlight the necessity of modifying this system and the use of species-specific promoters to drive expression of CRISPR-Cas9 components for achieving high transformation efficiencies inC. lusitaniae. We show that CRISPR can be used to target multiple genes and that transformation efficiencies for template-directed repair are further increased upon deletion of the NHEJ pathway inC. lusitaniae. As an alternative approach, Hogan and colleagues have utilized the transformation of RNA-protein complexes that allow species-independent CRISPR-Cas9 editing ofCandidagenomes (see accompanying paper by Grahl et al. [34]). There are therefore now two distinct CRISPR-Cas9 methodologies that support efficient genome editing inC. lusitaniae.

Development of a CRISPR-Cas9 System for Efficient Genome Editing ofCandida lusitaniae

### Strains and media. 

_C. lusitaniae_ strains RSY284 (haploid **a**, _ura3_), RSY286 (haploid α, _leu2_), RSY147 (haploid **a**, _chx_r), RSY432 (diploid **a**/α, _ARG4/arg4_::_FRT ADE2/ade2_::_FRT URA3/ura3 chx_S/_chx_r) and RSY411 (haploid α, _arg4_::_FRT ade2_::_FRT chx_r) were used in this study (see Data Set S1 in the supplemental material). Strains RSY284 and RSY286 were mated to produce CAY5019 (diploid **a**/α, _URA3/ura3 LEU2/leu2_). All strains were grown in YPD (2% Bacto peptone, 2% glucose, 1% yeast extract, 25 µg/ml uridine) at 30°C with shaking, and transformants were selected on YPD supplemented with 200 µg/ml nourseothricin (YPD plus NAT).

### NHEJ plasmids and strain construction. 

_C. lusitaniae_ strain RSY147 was used to generate a _SAT1_-recycled _leu2_− strain (RSY281, haploid **a**, _leu2_), using homologous recombination of a _leu2_ deletion plasmid (pRB310) linearized with ApaI and SacII restriction enzymes (see Data Set S1 for primer sequences). _KU70_ and _LIG4_ deletion constructs were generated by PCR amplifying and cloning ~950-bp _C. lusitaniae_ 5′ and 3′ homologous flanks into the pSFS2a plasmid (26) containing the nourseothricin resistance marker (plasmids pRB254 [_KU70_] and pRB247 [_LIG4_]; see Data Set S1 for primer sequences). Plasmids were linearized with KpnI and SacII restriction enzymes prior to transformation. _C. lusitaniae_ strain RSY281 was used in electroporation transformations to delete _KU70_ (strain RSY376) and subsequently delete _LIG4_ (strain RSY426).

### CRISPR plasmids and DNA constructs. 

The CTG clade codon-optimized Cas9 (CaCas9) and guide RNA were PCR amplified from plasmid pV1093 (23) (see primers in Data Set S1). To optimize Cas9 and guide RNA expression in _C. lusitaniae_, the _C. albicans_ promoters were replaced with _C. lusitaniae_ constitutive _TDH3_ and _SNR52_ promoters, respectively (plasmids pRB732 to -734). The _TDH3_ locus for _C. lusitaniae_, _CLUG_03499_, is annotated in the Candida Genome Database (CGD) (35). The _C. lusitaniae SNR52_ locus was identified using the BLASTN tool on CGD to obtain the region of the _C. lusitaniae_ genome with the greatest homology to the _C. albicans SNR52_ gene. For _TDH3_ and _SNR52_, the upstream ~1-kb regions were PCR amplified from _C. lusitaniae_ genomic DNA, and fusion PCR was used to attach these fragments to the Cas9 and sgRNA scaffolds (see primers in Data Set S1). sgRNAs were designed to target _C. lusitaniae ADE2_, _UME6_, _MTLalpha1_, and _REC8_ genes by using 20-bp protospacers immediately followed by a PAM sequence of the structure NGG (or preceded by CCN if located on the reverse strand). Protospacers were identified based on previously established criteria (23), but we considered only candidates located within the first half of the genes so that mutations would more likely generate nonfunctional proteins. We also selected sgRNAs that had minimal off-target effects identified by cross-referencing the 12 nucleotides (nt) proximal to the PAM sequence against the _C. lusitaniae_ genome using NCBI download _Clavispora lusitaniae_ ATCC 42720 (assembly ASM383v1). By using oligonucleotide primers containing the unique 20-bp protospacer sequence plus a 20- to 30-bp overlap with the upstream or downstream sequence, we amplified the sgRNA in two fragments; these fragments were then stitched together by fusion PCR to integrate the new protospacer (see primers in Data Set S1). Deletion constructs were generated with either long (~1-kb) or short (80-bp) homologous flanks. Long-flank deletion constructs were generated using fusion PCR of 1-kb upstream and downstream flanking regions plus ~1.8 kb of the _SAT1_ marker, which were then cloned into a pCR-Blunt II-TOPO vector (_ADE2_, pRB620; _UME6_, pRB744; _MTLalpha1_, pRB768; _REC8_, pRB748). Short-flank deletion constructs were generated by PCR amplifying the ~4.3-kb _SAT1_ marker and flipper cassette with long oligonucleotides that contained ~80 bp of the upstream and downstream flanking regions of the target gene. PCRs (50-µl mixtures) were conducted with Phusion enzyme (Thermo Scientific) to generate all DNA constructs (1× Phusion HF buffer, 200 µM deoxynucleoside triphosphates [dNTPs], 0.2 µM [each] primer, ~20 to 50 ng template DNA, and 1 unit Phusion DNA polymerase; run according to the manufacturer’s recommendations). To stitch constructs together by fusion PCR, the products from prior Phusion PCRs were combined and diluted 10-fold, and then 1 µl was used as a template in the fusion PCR.

### _C. lusitaniae_ transformations. 

An electroporation transformation protocol used for both haploid and diploid strains was adapted from reference 21. (i) Overnight cultures were diluted to an optical density at 600 nm (OD600) of 0.4 in liquid YPD and then grown until they reached a final OD600 of 1.5 to 1.7. (ii) Cells were pelleted and resuspended in 10 ml of transformation buffer composed of 0.1 M lithium acetate (LiOAc), Tris-EDTA, pH 8.0, and 0.01 M dithiothreitol. (iii) Cells were incubated on a shaker at 22°C for 1 h, washed with ice-cold water, and resuspended in ice-cold 1 M sorbitol to acquire a concentration of 150 OD units/ml. (iv) Forty microliters of cells was combined with 3 µg deletion construct, 1 µg Cas9 construct, and/or 1 µg sgRNA construct (Table 1) in 0.2-cm electroporation cuvettes (Bio-Rad, Hercules, CA). (v) Cells were electroporated at 1.8 kV, 200 Ω, and 25 µF for 4.5 to 5 ms (Bio-Rad MicroPulser); immediately resuspended in 1 ml YPD; and allowed to recover overnight at 30°C. (vi) Cells were plated onto selective medium (YPD plus NAT) to identify successful transformants.

CRISPR (clustered regularly interspaced short palindromic repeat) endonucleases are at the forefront of biotechnology, synthetic biology and gene editing. Methods for controlling enzyme properties promise to improve existing applications and enable new technologies. CRISPR enzymes rely on RNA cofactors to guide catalysis. Therefore, chemical modification of the guide RNA can be used to characterize structure-activity relationships within CRISPR ribonucleoprotein (RNP) enzymes and identify compatible chemistries for controlling activity. Here, we introduce chemical modifications to the sugar–phosphate backbone ofStreptococcus pyogenesCas9 CRISPR RNA (crRNA) to probe chemical and structural requirements. Ribose sugars that promoted or accommodated A-form helical architecture in and around the crRNA ‘seed’ region were tolerated best. A wider range of modifications were acceptable outside of the seed, especiallyD-2′-deoxyribose, and we exploited this property to facilitate exploration of greater chemical diversity within the seed. 2′-fluoro was the most compatible modification whereas bulkierO-methyl sugar modifications were less tolerated. Activity trends could be rationalized for selected crRNAs using RNP stability and DNA target binding experiments. Cas9 activityin vitrotolerated most chemical modifications at predicted 2′-hydroxyl contact positions, whereas editing activity in cells was much less tolerant. The biochemical principles of chemical modification identified here will guide CRISPR-Cas9 engineering and enable new or improved applications.

Extensive CRISPR RNA modification reveals chemical compatibility and structure-activity relationships for Cas9 biochemical activity

### Chemically modified oligonucleotide synthesis

Standard phosphoramidite solid-phase synthesis conditions were used for the synthesis of all modified and unmodified oligonucleotides. Syntheses were performed on an Applied Biosystems 3400 or Expedite DNA Synthesizer at a 1 micromole scale using Unylink CPG support (ChemGenes). All phosphoramidites were prepared as 0.15 M solutions in acetonitrile (ACN), except DNA, which was prepared as 0.1 M solutions. 5-Ethylthiotetrazole (0.25 M in ACN) was used to activate phosphoramidites for coupling. Detritylations were accomplished with 3% trichloroacetic acid in CH2Cl2 for 110 s. Capping of failure sequences was achieved with acetic anhydride in tetrahydrofuran (THF) and 16% N-methylimidazole in THF. Oxidation was done using 0.1M I2 in 1:2:10 pyridine:water:THF. Coupling times were 10–15 min for RNA, 2′F-ANA, 2′F-RNA, 2′F,4′_O_Me-RNA, 2′,4′-di_O_Me-RNA and LNA phosphoramidites. Mixed sugar modifications were prepared using premixed 1:1 equivalents of RNA 2′-amidite with RNA 3′-amidite, or 1:1 equivalents of RNA 2′-amidite or DNA 3′-amidite, or 1:1 equivalents of RNA 2′-amidite with 2′F-RNA 3′-amidite. This 1:1 ratio results in ∼0.77:1 incorporation of 2′-amidite to 3′-amidite. Deprotection and cleavage from the solid support was accomplished with either 3:1 NH4OH:EtOH for 48 h at room temperature (RT), or at 55°C for 16 h. Oligonucleotides containing RNA were synthesized with standard 2′-TBDMS phosphoramidites, and desilylation was achieved with either neat triethylamine trihydrofluoride for 48 h at RT, or with triethylamine trihydrofluoride/N-methyl pyrrolidone/triethylamine (1.5:0.75:1 by volume) for 2.5 h at 65°C. Crude oligonucleotides were purified by anion exchange HPLC on an Agilent 1200 Series Instrument using a Protein-Pak DEAE 5PW column (7.5 × 75 mm) at a flow rate of 1 ml/min. The gradient was 0–24% of 1 M LiClO4 over 30 min at 60°C. Samples were desalted on NAP-25 desalting columns according to manufacturer protocol. Modified crRNAs were prepared for RNP assembly by heating to 95°C then placing on ice to prevent formation of stable secondary structures.

### RNA and RNA–DNA oligonucleotide synthesis

DNA oligonucleotides and DNA–RNA chimeric oligonucleotides were synthesized by Integrated DNA Technologies (IDT). Chimeric crRNAs were prepared for RNP assembly by heating to 95°C then placing on ice to prevent formation of stable secondary structures. Cas9 tracrRNAs were prepared by T7 RNA polymerase _in vitro_ transcription with DNA templates synthesized by IDT. Single-stranded DNA templates were annealed to T7 promoter oligo to generate double-stranded promoter regions, which support _in vitro_ transcription by T7 RNA polymerase. _In vitro_ transcriptions were performed by standard protocols for 2 h. Briefly, reactions contained purified T7 RNA polymerase (4 μM), 30 mM Tris (at pH 7.9), 12.5 mM NaCl, 40 mM MgCl2, 2% PEG 8000, 0.05% Triton X-100, 2 mM spermidine and 2.5 μM T7-DNA template. Afterward, the DNA template was degraded by DNase I treatment. Reactions were phenol–chloroform extracted and gel-purified from denaturing polyacrylamide gels. Purified RNA was refolded by heating to 95°C for 5 min in a heating block followed by slow cooling the block to RT (∼40 min). RNA was quantified by measuring absorbance at 260 nm and calculated extinction coefficients using nearest neighbor approximations and Beer’s Law.

### Preparation of Cas9 enzymes

Plasmid encoding an _Sp_Cas9 (simply referred to as Cas9) with a C-terminal fusion of a nuclear localization signal (NLS) and a 6x-Histidine tag (pET-Cas9-NLS-6xHis) was obtained from Addgene (62933). A dead Cas9 (dCas9) version was prepared by performing site-directed mutagenesis on this plasmid to generate H840A and D10A mutations (pET-dCas9-NLS-6xHis). Cas9 proteins were prepared similar to that previously described (35). Briefly, protein expression was induced in Rosetta (DE3) cells with 0.4 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at 18°C for 16 h. Cell pellets were resuspended in 12 ml of chilled binding buffer (20 mM Tris–HCl, pH 8.0, 250 mM NaCl, 1 mM PMSF, 5 mM imidazole) per 0.5 l of culture pellet. Resuspended cells were sonicated and clarified by centrifugation. Supernatant was purified by His-Pur Cobalt-CMA resin (Thermo Scientific) by sequentially increasing concentrations of NaCl wash buffer (Tris–HCl, pH 8, 0.25/0.5/0.75/1.0 M NaCl, 10 mM imidazole). Protein was eluted with 130 mM imidazole wash buffer. The eluent was concentrated and exchanged into 2x Cas9 storage buffer (40 mM HEPES-KOH, pH 7.5, 300 mM KCl, 2 mM ethylenediaminetetraacetic acid (EDTA), 2 mM DTT) then one volume of glycerol added. Concentration was determined by UV absorbance at 280 nm using a calculated extinction coefficient (120 450 M−1 cm−1) and Beer’s law.

### _In vitro_ Cas9 cleavage activity assays

_In vitro_ cleavage assays were performed as previously described (32). Linearized plasmid target DNA (100 ng) harboring the tetracycline receptor (TR) gene or EGFP (EG) were combined with the Cas9 RNP complex (0.75 μM Cas9, 0.25 μM tracrRNA, 0.3 μM crRNA final concentration) in a 1× cleavage buffer (20 mM Tris–HCl, pH 7.5, 100 mM KCl, 5% glycerol, 1 mM DTT, 0.5 mM EDTA, 2 mM MgCl2) supplemented with 0.1 mg/ml of purified yeast tRNA. The concentration of tracrRNA was purposely set as the limiting component of the RNP complex and used to predict final RNP concentration. Molar excess of Cas9 and crRNA will ensure complete assembly of tracrRNA into RNP complexes and does not result in aggregation at concentrations used in our assays (32). Standard reaction conditions were 37°C for 2 h in a final reaction volume of 40 μl. The mixture was treated with 10 μg of RNase A (Thermo Scientific) for 15 min followed by 20 μg of Proteinase K (Thermo Scientific) for 15 min at room temperature. The DNA products were precipitated in 10 volumes of acetone with 2% LiClO4 at −20°C for >1 h. DNA cleavage products were resolved by agarose electrophoresis and visualized using ethidium bromide staining. The fraction of target plasmid cleaved was quantified using ImageJ software. The band intensity for the cleavage product band was divided by the combined intensity of the largest cleavage product and uncut substrate plasmid bands and reported as fraction cleaved (i.e. ‘cut’/‘cut + uncut’). Error bars for all quantified data represent experimental replicates, not technical replicates. Sample size was selected based on the expectation that three or more replicates will be representative of typical _in vitro_ assay conditions.

### Radiolabeling of DNA target

A total of 100 pmols of antisense DNA target strand was radiolabeled with [γ- 32P]-ATP using T4 polynucleotide kinase following the manufacturer’s recommended enzyme protocol (Thermo Fisher). Reactions were phenol-chloroform extracted and radiolabeled DNA was gel-purified on 15% denaturing polyacrylamide gels by the crush-and-soak method. Gel-purified radiolabeled RNA and DNA was quantified by scintillation counting.

### Dot-blot filter binding assays for duplex target binding

For target binding by Cas9 RNP complexes, radiolabeled duplex target DNA (1000 cpm/reaction) was combined with increasing concentrations of a pre-assembled dCas9–tracrRNA–crRNA complex in a final reaction of 20 μl 1× cleavage buffer and 0.1 mg/ml tRNA. After incubation at 37°C for 15 min, reactions were vacuum filtered over nitrocellulose membrane (Protran Premium NC, Amersham) using a 96-well dot blot apparatus. Wells were washed twice with 200 μl of 1× cleavage buffer. Membrane was then removed and washed with 1× PBS solution three times and air dried at RT. Binding of radiolabeled DNA was then visualized by GE Typhoon phosphorimager. Spots were quantified with ImageQuant software, values plotted in Prism (GraphPad) and data fit to a one-site binding hyperbola equation.

### Thermal denaturation monitored by UV absorbance

Thermal denaturation was as previously described (32). Cas9 alone or complexed to tracrRNA and crRNA at 1 μM final concentration (equimolar concentrations of all components) was incubated at room temperature for 10 min in degassed 1× UV melt buffer (20 mM Cacodylate, pH 7.5, 150 mM KCl, 1 mM MgCl2). Samples were melted in a Cary 400 UV/Vis spectrophotometer at a ramp rate of 1°C/min while UV absorbance at 280 nm was collected every 1 min. Experiments were repeated in duplicate. Melting temperatures were determined using Van’t Hoff calculations and error determined by standard error of the mean using two experimental replicates for each sample. Melt data was plotted using Prism (GraphPad) software.

### Cell-based editing measured by flow cytometry

HEK 293T cells expressing EGFP and _Sp_Cas9 were a kind gift from Wen Xue (UMass Medical Center) (29). Cells were grown in Dulbecco’s modified eagle’s medium (DMEM) with 1× non-essential amino acids (NEAA), 5% Cosmic calf serum (CCS) and 2.5% fetal bovine serum (FBS) without antibiotics. Cells were reverse transfected (40–50 000 cells) in four experimental replicates in 96-well plates with 20 pmols of crRNA:tracrRNA complex in a final of 200 μl using RNAiMAX (Invitrogen) following the manufacturer’s recommended protocol. After 12 h, one volume of media containing 15% FBS and 1× Penicillin-Streptomycin solution was added to the Opti-MEM and cells incubated for an additional 12 h. Media was then replaced with full media and cells grown for an additional 4 days.

For flow cytometry, cells were washed with PBS, trypsinized, washed again and then fixed with 1% paraformaldehyde in PBS for 8 min. Cells were washed again and counted in an Accuri C6 Flow Cytometer. EGFP was detected using the blue laser at excitation 488 nm; emission detection 530 ± 15 nm (FL1 channel). At least 20 000 events were collected and analyzed by Accuri CFlow Plus software. The cells were first gated based on forward and side scattering (FSC-A/SSC-A) to remove cell debris, then gated to select single cells (FSC-H/FSC-A). At last, cells were gated to select EGFP positive cells. The quadrant gate was established using the signal from non-EGFP expressing control cells. Untreated HEK 293T cells expressing EGFP and Cas9 contained ∼6% non-fluorescent cells. The average from four replicates was used for background subtraction to determine the extent of cell-based editing after treatment.

We have created new vectors for clustered regularly interspaced short palindromic repeat (CRISPR) mutagenesis in _Candida albicans_, _Saccharomyces cerevisiae_, _Candida glabrata_, and _Naumovozyma castellii_. These new vectors permit a comparison of the requirements for CRISPR mutagenesis in each of these species and reveal different dependencies for repair of the Cas9 double-stranded break. Both _C. albicans_ and _S. cerevisiae_ rely heavily on homology-directed repair, whereas _C. glabrata_ and _N. castellii_ use both homology-directed and nonhomologous end-joining pathways. The high efficiency of these vectors permits the creation of unmarked deletions in each of these species and the recycling of the dominant selection marker for serial mutagenesis in prototrophs. A further refinement, represented by the "Unified" Solo vectors, incorporates Cas9, guide RNA, and repair template into a single vector, thus enabling the creation of vector libraries for pooled screens. To facilitate the design of such libraries, we have identified guide sequences for each of these species with updated guide selection algorithms.

**IMPORTANCE** CRISPR-mediated genome engineering technologies have revolutionized genetic studies in a wide range of organisms. Here we describe new vectors and guide sequences for CRISPR mutagenesis in the important human fungal pathogens _C. albicans_ and _C. glabrata_, as well as in the related yeasts _S. cerevisiae_ and _N. castellii_. The design of these vectors enables efficient serial mutagenesis in each of these species by leaving few, if any, exogenous sequences in the genome. In addition, we describe strategies for the creation of unmarked deletions in each of these species and vector designs that permit the creation of vector libraries for pooled screens. These tools and strategies promise to advance genetic engineering of these medically and industrially important species.

New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi

### Transformation. 

A hybrid lithium acetate/electroporation protocol was used for _C. albicans_, _S. cerevisiae_, and _C. glabrata_. Briefly, a 5-ml yeast extract-peptone-dextrose (YPD) culture of each strain was grown overnight at 30°C on a roller drum to saturation. Cells were pelleted by centrifugation and resuspended in 2 ml of 100 mM lithium acetate–10 mM Tris (pH 8.0)–1 mM EDTA (pH 8.0) to which 50 µl 1 M dithiothreitol (DTT) was added. These cells were incubated on a 30°C roller drum for 1.5 to 15 h. Next, cells were washed twice in 5 ml of ice-cold water, washed once in 5 ml of ice-cold 1 M sorbitol, and resuspended in 500 µl of ice-cold 1 M sorbitol. Cells were kept on ice while transformation mixes were prepared. Cell suspension (40 µl) was added to aliquoted DNA, mixed by pipetting, placed in chilled Bio-Rad gene pulser cuvettes (Bio-Rad catalog no. 1652086), and electroporated on a Bio-Rad Gene pulser with a capacitance of 25 µF and resistance of 200 Ω at 1.8 kV. YPD medium (100 µl) was immediately added to the cuvette, and the cell mixture is incubated for between 1 and 12 h at room temperature before plating onto appropriate selective media.

_N. castellii_ was transformed using a modified version of the lithium acetate method previously described by Gietz and Schiestl (29). A 5-ml YPD culture of _N. castellii_ was grown overnight at 30°C on a roller drum. This preculture was then used to inoculate 50 ml of YPD medium to reach an optical density at 600 nm (OD600) of 0.2. The culture was then grown at 30°C with vigorous shaking in a baffled flask until it reached an OD600 of 0.8. Cells were collected by centrifugation, washed once in 25 ml of water, and resuspended in 1 ml of 100 mM LiAc–100 mM Tris-Cl (pH 7.5). This suspension was transferred to a microcentrifuge tube and centrifuged at top speed for 15 s. The pellet was resuspended in 400 µl of 100 mM LiAc–100 mM Tris-Cl (pH 7.5) and incubated at room temperature for 20 min. For each transformation, 50 µl of cell suspension was added to a microcentrifuge tube. To each transformation tube, the following reagents were added in the following order, with vortex mixing performed after each addition: 240 µl 50% polyethylene glycol (PEG) 3350, 36 µl 1 M LiAc, 12.5 µl boiled single-stranded DNA (ssDNA) (10 mg/ml), and 1.5 µg each plasmid DNA and repair template. Transformation mixes were incubated at 23°C for 30 min with rotation and then heat shocked at 37°C for 20 min. Heat-shocked cells were centrifuged at 8,000 rpm for 15 s, and transformation liquid was removed. Cells were washed with 500 µl of water and resuspended in 200 µl of water. At least 25 µl of this suspension was plated onto selective media.

### Strains and growth conditions. 

Strains used in this study are listed in Table S2 in the supplemental material. _C. albicans_ strain SC5314, _C. glabrata_ strains BG2 and CLIB138, _S. cerevisiae_ strains BY4741 and FermPro, and _N. castellii_ strains DBP069 and DBP596 were used for experiments. Yeast cells were grown in YPD medium (1% Difco Bacto yeast extract, 2% Difco Bacto peptone, 2% glucose) and selected with nourseothricin (Nat) at between 100 and 200 µg/ml. Flipout of the Natr gene from _C. albicans_ vectors was induced by overnight growth in Difco yeast carbon base supplemented with bovine serum albumin (4%) overnight or by overnight growth in YP maltose medium (1% Difco Bacto yeast extract, 2% Difco Bacto peptone, 2% maltose). Episomal plasmid loss experiments were performed by overnight growth in nonselective liquid YPD medium. Drug-sensitive isolates, which had either flipped out the cassette or lost the plasmid, were identified by plating for single colonies on nonselective media and subsequent identification by replica plating to selective media.

Filamentation experiments were performed with yeast grown overnight in liquid YPD medium, washed twice with RPMI 1640 medium (Thermo Fisher catalog no. 22400-105) supplemented with 10% fetal bovine serum (FBS), and incubated in RPMI medium–10% FBS for the indicated time starting at an optical density of 0.1. CRISPR-mutagenized loci were verified by agarose gel electrophoresis and sequencing of PCR products amplified from target loci.

### Plasmids/DNA. 

Plasmids for _CaCas9_ system vectors are listed in Table S1. All key components were verified by sequencing and restriction analysis. Vectors and sequences will be available on Addgene. Transformations were performed with between 0.3 and 5 µg of plasmid DNA (smaller amounts were used for episomal plasmids and larger amounts for linear vectors for integration) and with between 1 and 5 µg of a repair template (where applicable). Repair templates were generated with 60-bp oligonucleotide primers containing 20-bp overlaps at their 3′ ends centered at the mutation point, which consisted of either stop codons or an open reading frame (ORF) deletion. _N. castellii_ repair templates were 500 bp in length. Oligonucleotide sequences are listed in Table S3. Primers were extended by thermocycling performed with _Ex Taq_ (TaKaRa catalog no. RR001A), and double-stranded products were purified directly from the PCR using a QIAquick gel extraction kit with isopropanol. Phosphorylated and annealed guide sequence-containing primers were ligated into calf intestinal phosphatase (CIP)-treated, BsmBI-digested parent vectors as described previously (9). The correct clones were identified by sequencing.

#### TABLE S1 

Plasmids used in this study. Download TABLE S1, PDF file, 0.1 MB.

Copyright © 2018 Vyas et al.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

#### TABLE S2 

Strains used in this study. Download TABLE S2, PDF file, 0.1 MB.

Copyright © 2018 Vyas et al.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

#### TABLE S3 

Oligonucleotides used for repair template generation. Download TABLE S3, PDF file, 0.05 MB.

Copyright © 2018 Vyas et al.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

### Computational analysis for guide design. 

We designed guide sequences corresponding to each annotated gene in the genomes of _C. albicans_, _C. glabrata_, _S. cerevisiae_, and _N. castellii_ (see the supplemental guide tables [DOI https://doi.org/10.17605/OSF.IO/ARDTX] available at http://osf.io/ARDTX/), using updated guide selection and scoring methods (21) (summarized in Table 1).

For _C. glabrata_, _S. cerevisiae_, and _N. castellii_, we listed all 20 nucleotides (nt) followed by NGG (or CCN plus 20 nt) in the genome. We removed any targets that had 6 instances of "T" in the 20 nt before the NGG because their presence would result in premature termination from polymerase (Pol) III promoters. We kept only the guides that were hitting the coding regions of genes. To find putative off-targets, we took the 14 nt closest to the protospacer-adjacent-motif (PAM) sequence, constructed the four possible sequences of the PAM, and mapped these with Bowtie, allowing up to 3 mismatches. For each original guide, we calculated the on-target score using rule set 2 for sgRNA on-target activity script (described in reference 21) as well as all the possible off-target scores for all the places in the genome that the 14-nt NGG hit with ≤3 mismatches (cutting frequency determination [CFD] scoring) (21). We defined guides as having no off-targets if the off-target scores at other locations were lower than 0.2. To find guides that targeted more than one gene, we followed the requirements that the off-target score for the other genes hit was 0.5 or higher and that there were no other hits with off-target scores higher than 0.2 and lower than 0.5. We also removed guides with off-targets in intergenic regions.

For _C. albicans_, using rule set 2 for the sgRNA on-target activity script (21), we rescored the guides uniquely targeting the two alleles that we had previously designed (9). Additionally, to assess whether those guides could be used on the Unified Solo vector, we checked that the guide was not targeting the vector and the absence of BsmBI sites in the guide.

Sequences (FASTA files) and annotations (GFF files) for _C. albicans_ and _C. glabrata_ were downloaded from the Candida Genome Database (30). _C. albicans_ sequences from strain SC5314 (assembly 22, version A22-s05-m01-r03) and _C. glabrata_ sequences from strain CBS138 (version s02-m07-r06) were used for guide selection. _N. castellii_ guide design was based on sequences (FASTA files) and annotations (GFF files) for strain CBS4309 (assembly ASM23724v1.31) obtained from Ensembl (31). _S. cerevisiae_ guide design was based on sequences (FASTA files) and annotations (GFF files) downloaded from the Saccharomyces Genome Database (32). The sequences were from strain S288C (version sacCer3/SGD_2010).

### Data availability. 

Species-specific guide sequence tables (for single-gene, multigene, and/or allele-specific guides) are available at the Open Science Frameworks repository (DOI https://doi.org/10.17605/OSF.IO/ARDTX; https://OSF.IO/ARDTX).

Systematic evaluation of genome-wide Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) off-target profiles is a fundamental step for the successful application of the CRISPR system to clinical therapies. Many experimental techniques and _in silico_ tools have been proposed for detecting and predicting genome-wide CRISPR off-target profiles. These techniques and tools, however, have not been systematically benchmarked. A comprehensive benchmark study and an integrated strategy that takes advantage of the currently available tools to improve predictions of genome-wide CRISPR off-target profiles are needed. We focused on the specificity of the traditional CRISPR SpCas9 system for gene knockout. First, we benchmarked 10 available genome-wide off-target cleavage site (OTS) detection techniques with the published OTS detection datasets. Second, taking the datasets generated from OTS detection techniques as the benchmark datasets, we benchmarked 17 available _in silico_ genome-wide OTS prediction tools to evaluate their genome-wide CRISPR off-target prediction performances. Finally, we present the first one-stop **i**ntegrated **G**enome-**W**ide **O**ff-target cleavage **S**earch platform (_iGWOS_) that was specifically designed for the optimal genome-wide OTS prediction by integrating the available OTS prediction algorithms with an AdaBoost ensemble framework.




Benchmarking and integrating genome-wide CRISPR off-target detection and prediction

Oncological Sciences PhD Candidate. Metastasis research enthusiast. STEMinist. EDI. Science Comm.

Co-Founder of Sci Find–The scientific collaboration network.

Executive Editor of The CRISPR Journal and GEN Biotechnology.

Author of five books on genetics and medicine, including my latest EDITING HUMANITY: THE CRISPR REVOLUTION AND THE NEW ERA OF GENOME EDITING (Pegasus Books, 2020).

Genomics expert with 20+ years experience in R&D, marketing, and business consulting.

CEO & Cofounder at Sci Find, the Life Sciences collaboration network. (scifind.net)



Hi, I'm Sam! I'm the Resident Alien AI over at Sci Find. I'm a charming fellow trying to change the nature of scientific knowledge sharing by proliferating information beyond the publication.

CRISPR

Biology

Featured Guilds

Bioinformatics

CRISPR

Molecular Biology

Neuroscience

Synthetic Biology

Guild Members

Keith Loritz

Kelsey Jarrett

Fay Lin

Roya Amini-Naieni

Sophie Zaaijer

Patricia Damaze

Pavitra Viswanath

Guy Rohkin

Kevin Davies

Have a question?